

>tg0612 SAM-dependent methyltransferase, putative

>tg0612 SAM-dependent methyltransferase, putative

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 582504 - 584700 (Additional range around tg0612 is :500nt.)

>Thermococcus gammatolerans EJ3 AGAAGAACGAACTGCATGGCCGTTCTGATGATACCTATTCTCATAAGGTGAGAAAAGGAATCAAGAGCCCTTCTCCCTGG CTATCCTCTGGAACTCGGCGTAATCGGTAACGATCCTCTTTCCGTCGAGGGTCTCGAAGTAGACCTTCTTTTTCTTTATC TTCTTAACGTCGGTGTACTTCATCTCGGGGGGGTCGTAGGAGCCGGGCTCGACAACTTCGTCCTCAACAACGTAGGTCTT CAGCTCGGGCTGGCCGATGTACTTCCAAACCTCATAGAAGACCTCGGGGTCGAGGTGTATTTCCCCCTCGATCTCAATCC AGTCCGCCCCGATGTCCTCAAGAAACTCTTTGACGACCTCAAAGTGCATAGAATCACCCCCTGGGTATATACGCTTCCCG GAGTTAAATACCTATCGCTGGAGGAAGTGGAAGATCCTGGAGGAACACCAACTCGGGCAACCTTTTAAAGAGGGGCGCGT ACTGGCCTCGGTGGTGAAG atggcgagggtaatcgttgacgctcaggcggcgagagcgatcggaaagggcgcgatgata gtcttcaagaagggagtggtgagaaccgagggcgagtttgaacccggcgacatagtcgaggtctatacgcgcgggggcaa attccttggcaggggcttcgtcaaccccaactcgaacataatggtccgcctgctcattaaggacagggaaaccccgataa cgaaggagctcttccgtgagaggataaagaaggccaacgagtacagaaagaaggttctcggctacgacaaggcctacaga atggtctacggcgaggccgattatctgcccggtctcatagttgaccgcttcaacgagattgcctcggttcagatttcgag cgttggaatggagcgcttcaagctcgacgttgccgaggccataatggaggccgagccagagattgaaaccgtcttcgaga agaacaccggaaggagcaggcgcagggaaggtctgcccgaaatagagagggttttgctcggaaaggagaagtaccgcacc ataatcgaagaaggtaaggcaaagttcatcgtggacatgcgcgggcagaagacgggcttcttcctcgaccagcgggagaa caggatagcccttgagaagtacgttaagccaggcatgagagttctcgacgtcttcacttacaccggaggcttcgccattc acgcggcagtagctggcgctgatgaggtcgttgccgttgataagtcaccctgggcaatcaacatggtgaaggagaacgcc aagctcaacggcgtcgaagacaggatgaggtacataacgggttcagccttccctgtaatggaggaaatgataaagaaggg tgagaagttcgacatagtgatcctcgatcctcccgccttcgtccagcacgagaaggacctcaagcgcgggctcagggcgt atttcaacgtcaaccacgccggcctgaagctcgttaaggagggtgggatcctcgtcacatgctcctgctcccagcacgtt gacatgcaggccttcaaggacatggtcatagcggcagcagccaaagccggcaagttcctcaagatgctcgagccctacag gactcaggcaccggaccacccgatactcatggcctcgaaggacaccgaataccttaagtgcctcttcctttatgttgagg acatgatgttgaggaca TGAAGTGATTAGCGGGACGATGACGAGAAAGCACCTCCACTGAGACCGGCGTGAGTGCTGAG ACGCCCACGGTCGGAGTCCCTCTAAATCATAGGGCCGCCAGAACTTCCAGGGCGGATTTAACCAGCAGTTCCTCCGCCCT TCTAAGTTTTTCACTCCCGAATCCAACGTTCCATTCCCCTCTATAAAGCTCATCTGAAACCGCCAGGGCAACCGCCAGCT CAACACCCCTAAACTCGGCAACGCTCATTAAGGCTGAACTCTCCATTTCAACGCCGAGAATCCCGCGCTTGGCGTATTCC TTTACTTTGTCCTCCGTTTCCCTGAAGGGCGCATCCGTCGTCCACACGCCTCCCCTGAAAACGCCAATTCTCCTCTTTCC TATTTGACGTCTCACCTCCTTTTCAAGCATGCTCAGCAGTTTCTCACTGGGCCTTGGGGTGTACTCAGGGGGCAGGTAGT GGTAGCTTGTTCCCTCCTCCCTCAGGGCCCAAGTCGGC