

>tg0615 hypothetical protein TGAM_0615

>tg0615 hypothetical protein TGAM_0615

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 585249 - 587445 (Additional range around tg0615 is :500nt.)

>Thermococcus gammatolerans EJ3 TAAAGAGCGCCCCCAAGTTCTCCTTCACGGAAGACGTAATCATAGACCCCTCCAACCCGCTTCAGATAGCAAAGTTCGTG AAGGAAACAACGACCGGCCTAATATCTGGAGGCTACACAGGGCAGCTGGTCGGCATCATTACCTCGCTGACACCGCTCTT CTTCGAGAGTGAGCTCATCGACATATACAAGTTCCTCGAAGAGCTCAAGGACATCGCACACAGGCACAAGCAGGTCTGGC TCATTGAGATAAACACCGGCATCGAAAGGCCGCAGGTGGAGGCAATGGTGAAGGCTATAGTGGACGGTGTCATCGAAATG AGGATGTTTGAGGAGGGCAGGACTCTGAGAAGGTACATAAGAGTATATGGAATGCGGAGGACGCCCCACTCCCTCTCGTG GTTCCCCTATGAGATAACGCCAACGGGACTCGCGTTGAGGGGGTAGCAGATCTACTGTTGTAAATAGTAAAGCTTTTAAA TTTTCGTGATTATCTCTTT ttgatgatgtctgatagaaggctatacaccgcacttgcactggtggcactgctctcaacg gcaggtctatttgccctgggagagaaccgcgatgacagcaccaaaagcttcgttggggtctgtgtgaaagcagagagaag ttactccatactcttcaactcaacggatacacttctcgtccccgagcaacttgagatagggaagctctataccctcagag gagagctggaggaaacgagaagcggccttcgagtaagcggaaaatactttctcaggccctactcagccatcccccaatgg ctcgaggagacggaaggtgcttactggatcagtagagggagaaggcactatctattaacccccgactgggttgagctggg gaaaccgctggatatccagaaaggaagcctcgtgagggttcttggagttaaatacggctcaaagttctatcctgtgaaaa taacccatgcgggaactccgtccagatcgataagggacggaatgccggcgctgataaggggaaccgttctcgggaccttc gggaacgaaaaccggatcgtactgtggaatggaagggagaagctgtacatctacctcccccacggccaaagccttgagag gggcctgaaagtggaagttctcggcagggtcagaataacgtcgagggttaacgtttacgtggacgacataggcgacgtga ggagactcggttatcccccaacggtaccaatagacaaaacctcgatcgggaagatcggaggaggagaatgcctcgtcctc agggttatgaagagcggcctcgtgctgaactgtacgagcctcaggctcaggggtttcaaagccagagcaggagatatgat aaaagtcagggccctcaacacgggctccagcttggtctgtctaagttgtgagctagcccttccgagggagaggcttccga acgggatatgcaacttccgtgagggcggtttttcgaagatagccggacgggtggagtgggtgaagaggtacggcaacggc tttgggctggccaacgtaacgagcggggaatgctgggttctcctgaagctccccaaatccctcggaatcgaggttaaaga gggaacggtcataaccgcctacggaaccttcacagattacaggggaaagcccgccctacaggtgagctcgggggatgacg tttgctccgggaactgc TGATCGGCCTCTTTCTCGGAACGTTCACGGGCCTAACACCGGGAATACATGTGAACACACTC GCGGGGATGGAGAGCTCCTTTTACCTGCTCTTTGCAATGGGTCTGACCCATACCTTTCTGGACGCGTTTCCATCCACGTT CCTCGGCGTTCCCGACGAGGGGACGGCACTCGGGGTTCTGCCGGCTCACAGGCTGGTTCTGGCGGGGAAAGGCCTAGAGG TGCTCAGGATTGCACTCCTGTCGAGCCTCCTTGCAGTGGTCTTCGTTATTCCTTTTCTGCCCCTCTACTCCCGCCTTGTG GTTCTCTACTCCCCAACCACCGGAAAGGTTGGAGTGCTGTTTCTCCTCGCCTTCCTCCTTCTCAGCGGGAGGGACAAAGC TCCACAGGCGGTTCTTGTTATAGCGCTCTCGGGAGTTCTGGGATGGACTGTTCTCAACCAGATGAACCTGAAAGAGCCCT TCTACCATCTCTTCACCGGGTTGTTTGGAATCCCCGTT