

>tg0620 L-aspartate oxidase (quinolinate synthetase B) (nadB)

>tg0620 L-aspartate oxidase (quinolinate synthetase B) (nadB)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 590998 - 593392 (Additional range around tg0620 is :500nt.)

>Thermococcus gammatolerans EJ3 TCCCTGTGGAAGGACTTGATGGCCCTGACGTGCTTTTCTTCAACCCTGCCGCAGCAGGCGACGCGCTCGTAGAAGCGCTG GAGCTCATCTAGGAGCCACTCGAGCTGTCTCTTGGAGCTTTCGCTGAAGCCATTGCCCAAGAGTTTTCCCCTCAGAAACG GCATGACCTCCGAAGGCCGTCCCCATGCGGCCCAGAAAAGACCTTCCTTCAAAATCTCAAACAGCAACTCCTCGGACTTC GCACTAACGAAGGGTTTCACCCTCCCCCCTAAGCTTTTCTGGAACCCTCCTTTGGATTTCGTAACTCCTCCTCATGGCAA TCACCGTAGAACGGACTGCGATGTCCTATATTGGCTTTTCGGGAGCTTTTTTGAACATCTGATGAAAGAGAAACTTTGAT ATAAAGACTGATTGAATTTTTTCTTTCCTAAATCCGGAAGGCCGACGATCCGACGAAGGCAGATTTTTAAGATGTACACC GAGCATCGTTCGGTGGTGGG atgaaaattggaatcgttggcgatggaatagctggcctgacttctgccatagcgcttgt caagaggggttttgatgttactctcatcggtcccggaattcgaaagagcaactcttatctcgctcaggctgggatagcct tcccggttctcgaaggcgattctctcgaggcccacgtcctcgacacaatcaaagccggaaagtacatcaacgaccgcgag gtcgtttggaacataatctcaaaggcgagcgaggcctacgattttctcacttccctcggcctgaagttcgaggcgagcga gactgaaggtggccactcattccacagggtctttacgattaagaacgagaccggcaagcacgtcacgaagctcctctacc tccgcgccagggagctcggcgttaacttcgtcaggggaaagacggaggaactcgcgacaaagagggggaaggcctgcggg gtgttcgtcgagggcgagttcctccgcttcgacgcgaccgttatagcgtccggtggattctcggggctcttcaagtttac ggcaggttctcccgagaacaccggcctcatcatcggcgacgcggtaatgaaaggctcccccgctcgcgatttggagttcg tccagttccacccgaccggttacattggaaagaaaggagttttcttgataagcgaggccgtgagaggggcgggggcaaag ttggtaaccgaagacggcgagcgcttcgtgaacgaactggcgacgagggacatcgtggcgagggcaatctaccgccagat gcaaactggaaagaaggtcttcctcgacgcgaccgggatagagaacttcaagaagcgcttcccccagatatacgctttcc tcaggaaggacgggatagacccatcgatggacttaatcccggtctcgccgatagcccactacacgatgggcgggatagcg gttgacctctggtatagaacttcactgaagaacctctacgcgataggagaggccatgagcaacggctttcacggggcgaa caggttggcgagcaactccctcgtggagtgcatcgtttctggccttgaagttgcgagaacgatagcgagggaaaggccga ggtgcagggaagttaaggagcctcactaccacggctacgaacccggagacgttgactcgctgagggagctcctatgggag catgctgggatagttaggagtgcgaagacccttagggagggcctccagaagcttgagggaatcgaggccgacccgaggct gaaactgctcgcgaagggcgtccttgagtgcgctttggcgagggaagagagcagggggagccactaccgtgaggactttc cggtcatgagaaaggccttcgagaggccgagcttcttcgacgggaggtgcaggctg TAACCAAAGGTGTCCAAAAACCC TTTTAATTCCCCTCTCCCACCTTCCGCCGAGGGGTGAGAGATGGACAGGGAAAAGCTGATCGCCGAGATTGAGAAGCTTA AGGAGGAGCGCAACGCGATAATCATGGCCCACAACTACCAGCTCCCCGAGGTGCAGGATATAGCGGATTTCCTTGGGGAC AGCCTCGAGCTCGCGAGGAAGGCCGTAAACGTTGATGCCGAGGTAATAGTCTTCGCGGGCGTCGATTTTATGGCCGAGAC CGCTAAAATCCTCAACCCCGAAAAGACTGTCCTCCTTCCGGCTAAAACGGCCACCTGCGCGATGGCCAACATGCTCCAGG TCGAGCACATACTTGAGGCGAAGAGGCGGTATCCTAACGCGCCAGTTGTCCTCTATGTGAACAGTTCCGCCGAGGCGAAG GCCCACGCCGACGTGACGGTAACTTCAGCCAACGCGGTTAAAATCGTCGAAAAGCTCGATTCCAACGTTGTAATCT