

>tg0629 Pyridoxine biosynthesis protein

>tg0629 Pyridoxine biosynthesis protein

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 599275 - 601279 (Additional range around tg0629 is :500nt.)

>Thermococcus gammatolerans EJ3 AAGGTCGTCTTTCTCGACGAGCCCTTCAGCAACGTGGACATAGTGGCCAAGAAGAGGATGATGGAGGTTTTCATGGAGCT CAAGCGGGAGCGCAACATAGTCATCGTCTCCCACGTTTTCACGAACATCGAGGAAATAGACAGCCTCGTCGTGCTCTACA ACGGAAAGGTTCTCAGAAACCTCCACGGGAAAGAACTCCAAGATATCGGGGGCTTCAAGGCAGTATTCTCCGATGGGTCG GTCGTTGTCAACGATTTGGACGAGCTGGTAGAGAGGATTAGAAACGGCCAGAGACCTGTTTCGATTAAACCGGTAACCCT CGAAGACTGGCTCATGGACTTCTTTTAGCCTTATCATCACATTCACCATCCGGTGAACCCCTTCGGCTTTCGATGCGTTT TTCTAAACATTTTTCATCCAAACCGTTCCATACCTGTGGCAAGGCTTATATTCTCTTTTTCAAATCCAAATCTGAAGGAA AGCCAAAAGGGGTGATCCGT atgggaaagctcgacattattgagaagaaaggtaccgagagactgaagaggggcttcgc caagatggtcaagggcggagtcatcatggacgtcaccaatgccgaacaggcgagaatcgctgaggaagccggagcagtcg cagtcatggccctccaccgcgttccagctgacatcagaaaagctggcggagtcgcgaggatggccccgatagagaagatc caggagataatggacgcagtgaccattccggttatggcgaaggttaggatcggccacgtcgccgaggcgagaatcctcga agctttgggtgttgacatgatcgacgagagcgaagttctgacgccgtctgacccgtacttccacatcgacaagcgcgagt tcaagattcccttcgtctgcggcaacaggaacctcggggaggccgtcaggaggatatgggaaggggccgcgatgatgagg acgaagggcgaagctggaacaggaaacatcatcgaggccgtcaggcacgtcaggcttttgaaggacaacatcgccctgct ccagcgcatgaccgacgaacagatctacggcgtcgccgagaagttcgccgagccatacctcaggctggccttcgaggtca gggagatcagcggcctgccaaagcaggtcctcgagaacgagccggtttacggccactacacctaccgcgagatcgttgag ggcctctacaagatactcctcgagataaagaagcttggccgccttccggtcgttaacttcgccgctggaggagttgcaac gcccgccgatgccgccctgatgatgcagatgggcatggacggcgtcttcgtcggttcgggcatcttcaagagctccaacc cgccgaagatggcgagggccatagtcgaggccgtgaaccactgggacgagcccgatgtgctcgtcgagataagcaaggaa atcggcgagccgatgcgcggtcaggacattgaggagcttgaggttaggctcgaggagaggggcgtc TGAGCCCTTTTCC ACTCTTTTGGAGGGGTTGAAATGGTCAAGGTAGGCGTTATAGGCCTCCAGGGAGACGTCAGCGAGCACATCGAGGCGGCT CAAAGAGCACTCGAAAACCTCGGAGTGAGTGGAGAAGTGATCTGGCTCAAAAAACCTGAACAGCTTGAGGGGATCTCGGC GATCATAATACCTGGAGGAGAGAGCACGACGATATCGAGACTCATGCAGAAAAACGGCCTCCTCGAGCCCGTCAGGAAGC TCGGCGAAGAGGGACTCCCCATTATGGGCACCTGCGCGGGCCTGATAATGCTCTCGAAGGAGGTAATAGGCGCCACTCCA GAGCAGAGGTTCCTCGAGCTCCTCGACGTTAAAGTGAACAGAAACGCCTACGGCAGGCAGGTGGACAGCTTCGAGGCGCC GGTAAAGCTCGCCTTCAGCGATGAGCCGTTTCCGGGAGTTTTCATACGTGCCCCGAGGATAGTGGAGCTCCTCAGCGACA AGGTGA