

>tg0650 hypothetical protein TGAM_0650

>tg0650 hypothetical protein TGAM_0650

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 619862 - 621995 (Additional range around tg0650 is :500nt.)

>Thermococcus gammatolerans EJ3 AGAGGGGGCGGGAAACCGGGAACGCCGCCGGCCACTCAAACGCCCGGGTGGTGTAGCCCGGCCTATCATACGGGACTGTC ACTCCCGTGACCCGGGTTCAAATCCCGGCCCGGGCGCCAAAACTCTTTCTAAGAGAGCTTTTACATGTTAGGAGCCTTAC TTTTGGAATGTTGATTGAGTGTTCTGATTATAAATAACGTCAGAAAACTTTAGATGGATGTTTGAACAACGGTGGGAGCT GCACCGGAACTTCCCTTGGATTCTAGAGATGACAGATAAAGGAACTCCCTTTATTCACATGGATGCAGAACCAAGACGTG TACTGTTTAAGCACAATCAATACTTGAGTTGATACCTTAAGTTCTTCTATTCGCATTTTTGCTGTTATTAATATAGCATA CAAGCTGAAACAGGCCAAGCTTGGGCTATTAAAAAGCTGGGGAGATAAGTGAGAGATAACCAAAAAATTTATTACTCTGT TTGATTGGCAGATAACAAGT atggtcaggaaagagcatagaatgtttgtcttaatcacctttgtatttacactgttcat tatgcttttctcggtacttagatttgaaactctgtcaaaatacggcattcacgacattgacttgcagattttctccgaaa gcctccaaacaaccctaactggacagggcttctttttcaatgaatgggagtggcaacactggagagcgtggagtcatttt ggaacacataactctccaatcctctttctgctgctcctcccctatgcccttgtacccagccagtatacgttgatactgct ccaggatctaatggtaacaatcagtgccattgtgcttttcaaattcgctgggtacatactaaatgatgaaaagaaagctc tgatagtttcagtggcatttctcatgaatccaattacccatggaatagtccgctacgactttaggccggacgtgctcgcg atgccgttcatgttcctcttcgcttactgtgtggcaaaaaacgacacgaaaaaaagtgtattggctgctctgtttgttgt ttctgttaaggaggatgcgggcctatttctcattgcgtactcaatgtttgaaatactctcaaagcgtggttttgcgatca gaacatggctcgaggaaaagagagcggtgggctttgcactcttggggctgtcttggatacttattagcattttcctcata attccgcatttcaacacaagtcataggtacatctactttatattatacaaaccggagataggcaaaagagcgtttatctt tgctgtggcgcttgcgaagctggtagttttgttcctcagcgtggcatttgttcctttaagacggcctgcttactggctac ctctggtattcctgtggtcggaaaatgctttttcaagcaggttggagcaggcggcaattggctttcaatatgactaccaa cttcttccaatggcgtttattgtattggtgtatgccctcaaagaatatgggtcagcgaatccaaagaaacttttactgtt ctcatttatctctgcactcatcttttcgccgatggtcggggttatcgatgcctacccagtcacacttggaatctcctttt ggaagtacataaaactattttggggaagaggactt TAGCTTGTCACGATGTTAGCGAGGACAGTTTTTAGGTAGTTTAA TCACGATTGCGGCTCTACCAACACGCTCAAAATTCAAAATATCAGTATAAACATATAACCAGTGGCACCTAGAATAACCC CACAGGAGGAAGCCAAGAATGCTAGAAGACCCTTAGAAGACTATTTTAAGAATGGCGGGCCCGGCGGGATTCGAACCCGC GACCTCCGGCTTAGAAGGCTACTCCTTTAACGAATTGTGGGCCTCTGAGAGGAGCAATTTCGTGGAATGGCTCTCTGCAG AGGTAAGAGAAGAAACAAAGAAAGACTACGTGAGATCGCTCGACCGGTTCTTTGGTCGGCACGTGATAAAAACGCTCGGA GACCTTGAGAAGGCCCTCCGTGCTGAAGGGCAAAAGCGTAATCTCGCCAAAGCGATCAGGAAGTTCTCAAAATACCTCCT CGAGCTCGGCATAATTGAACAGAGCACTTATGAAAAGATAAAGGCAGTCGTGAAA