

>tg0654 hypothetical protein TGAM_0654

>tg0654 hypothetical protein TGAM_0654

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 625354 - 628576 (Additional range around tg0654 is :500nt.)

>Thermococcus gammatolerans EJ3 AGATCCCGAAGGAAGGGAGCTATACGCTTGAACTCATGTGGAACGGCCACACTGCGGTCTATAACGTGCAAGTGAATCCT GCCATCTCGCTAAAGACGAGGACTCTGACAGTCGAGAAAGGCAGTGAGGGGACGATTATTCTGCACATTAAGAACCCGTC GAGCTCTGTCCAGTACTACACGATAAAAGTCTCTGGCGGTTTTCTACCGAAGGAGATCAGCCAGAGCATTTCAGTCGCTC CTCTCACAGAGAAAGACGTTAGCATAGCCTTCGCCGTGCCGGATAAGTTGACTTACGATGCTTACGAGCTTCAGGTGCAG GTTCTGCAGGGTGACAGGGAGGTGTTCAAGGACAGTGTTGCTGTCACGATCAGCGGTAGTTCTTCGGATGGTTTCATCCC GCTCGGCGAGGGTGGTTCTGGAACTACAATGCTCCTCCTCGCTGGAGGTGGACTTGCAGCTGTTTTGGGACTCATGATGA TTAGAAGGAGGCGGTGAGCT ttgaggccggtctcgttcttttccattttcaaaaagagggctgaggaagagcaggagaa gcaaaagaagcgcggggattggaggagcttcacttcaatagcgcttatgcttatgcttttagtcagtgtttacgctgagc ctgtagcggcatggccgggcgaggggctgttcagctctgttggggatgcattgagttcagttggtgatgcagtctcttcg gctgcgcatgctgtggtggataatattgagggtggcatagctggagctttagcgggtgcagctactggagcaatggtggg ttctgcagttccgggcattggaactgcaattggggcgggtgtaggtgcgttagtaggattcgttgggggagtgtatgcag agtacaaggcaaagcagacgatacatgagataactcatcctggtgggccgggagttggcatttcctacgagggaattaat gcaacaaaggatgacctcagcaagaacagcgacttgttaaaaaattatcagatcgtcgacaacgcgcagagcaaagcgta ttcagagcttgcagagttgctcgcaaaactcgcaacaaagcaaacagaatacagccttcacatgaccggctcaaccggaa acatccagctcaaactcttcgggccggacgaaatcaggggcttttcggcatttcccgtcaagctgagaattctaacttcg gcagatccaatcgagcggaacgtcatccacttgaagaaaatcacaatgtacgtcatcaaccccgacacgggaactgctta ctacacgtacacaaagacgttcacgggcaatgagacgagccttaacggtggggcttacgagatcaccactttcctgaaag ttcctgataagtacgactacgacgttgtccaagcaatccaaaccggccagatcacacaggatctcatcaacaagctcaag aatgctgaaactcctcagttcgaaatctttgtggaggttgacgcggtaaaggaggactggagcctcgacagtaacggaaa ttgggttcacgtgagggacatcccgctttctgttgaggcgcagaccgtcagcgtgtacactcacgtaaccgcatcaaggg atgtagtcctcttccagaccggcctaaacgcttctctcccctccgacatggccaacctcgtcatgggcaaattcgcgcca ttcatcgctgaacagtggggtggaatttcggacgtgatagtcaggccctacgccacgccggttcatgtggctgattcggc tgcgacttggaagttctttgtggcgccaaatcatggattcctcacgatgtttgacaagagcccggaggtctatgatgact ttgaggtctttgctatcagagtccttcagggcgggagctttgagctcgccgacaggagaaccaacagccttggtgatctc tctggcgagactgtaaaggaggcgtacggtataaccaagtacactactggctcggatgttgtgaattacagggtctatgc gctcggcttgatctggatcaagcgtgatgatgggacgaagattccggtttgggttcttgtgcagccacacatgactgtct tggacatggagaagctggcccttgatgacacgaggatacagaggattctaccgatttttgacgacaagaaaattaccgaa acagaactccagacgttgaaagctgaactcgattcagtaaagcaggacattcaggagaagattcaggctgcggagcagtt gaagaagatggcagaggccaacggcaatactgaggctgcggagtacgctgacagggcgatcaagtactaccagcttgagc tcaaaatgcttgatcaggccacgcagacagaggatgcgcagctcgcacttaactaccttaacgcggctaagaagtacgag tatgcgggcgattttgagaagcaggcggcggataaggcttacaagggtgattctgagggtgctaaagcccttgacagtca ggcgcaggagtacaagaaggccggtgatgactatgttcctcacttcagtgttggcggcttggcggacacgattcttggga atctgaaggatccgaagtacttggcgctgctggcggttctgctcatcggcggctactacttgttcggcaggatgggcgca atggttggagcagccatctggtttgctctcgtgattggtattcccgcactcaaggccctcgtggcctggttgggaacaaa actc TGAGGTGGTGAAAAGTGGGAGACGGTAAGGGCGGGGGCGCTGGCCCCCGATTTTCAAAATGGAGTTTTAGAGTAT TAGTGACGGCAATACTGGCCCTTATTGCATGGTACGCGGGACAGCACAACGTGACAGCGCAGGAATTCAACGAGGCTTTC GCCAGCATCCCACTCGCGGCGATAATCCTCGCGATGTTCTTCGACTACGGCCTCGATAGTGGCAAACTCTACGACAAGAT GATCAAAAAGCCAAGCAACAGAATGCTCGGCCTCATTTACGCGGTAATAGCTTCGGTAGTGTTCTTCTTCGCGTTCCTGT GGATCATTACCGGAAACATACAAGCTGCCAGTGCGGCTTCAGTCGTAGCCTCCGCAGTGGTTGCCTTATTAGTCCTCATG CCGAACACTGGAACTTCAGAGTGGATTCTCTGGCTTTGGATTGCGGAGACACTTGTCACGGCTGGAAAGTTCCTCACAAT CCTGCCGGGGGTGAGCTAATGGCT