

>tg0665 hypothetical protein TGAM_0665

>tg0665 hypothetical protein TGAM_0665

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 634133 - 636092 (Additional range around tg0665 is :500nt.)

>Thermococcus gammatolerans EJ3 TATCTGGATTTATGTTAAAGAGGGCGGGCGGACAGTCGAGGATTTTAAGCTTGTCAAGAGTCCGGTTGATGTTATTTTCA CAGCGCCTGAGGATGGTAATTATACGTTGTATATCGACAACAGTATGAGCTTGGTGAGTTCTAAGATCCTCCACTTGGAA CTCATCAGGCATTATTATGATTATGTGCCTGGAGGGTTGTTCCTCTTCTTTGGTTTTATAGCGTTGTTGGTGAGTCTTAT TGGCCTTATGATAGGGCAGAAACGACTTATGATAAGGGTTGGGGACGAAACTTATGAGTTTTGGCCCACGAATTGGGGAA AGGTAAACGTTGCGGTGAATGGTGTCACTCTTGATTCAAAAGTCAAGCCTGGCGATAAGTTTAGGATTGGCCCGAATGAT GAGCATATTTTGGAAATTAAGATGGTGGGCAGGTTTTTCAAGAAGACTGGTTTCTTCGTGGATGGTCGCGAGGTTGGTCG GTTGCCGTGAGGTGGTTAC atgaaactcaatatgcgacttgatgtgaacataattagaagtgtaaccattctaatggtg gtagttgctgtttttattgcggggctagcagttttgattggactcaatactcgagagcaaatgcttttgcagtctgtctt ggtaatggcaaatgtgttgatggctgcagttgtggcacttcaggccttagctactatggattcagtagaacaagcaaaaa aacaagcagaactgatgaataaaagccttatggaaatgaaaaagcagcgtatgaatatcgagttcatgaaaaacgagata attggttatatatctacaatagaagccagtttaagatctaacttacaagaacactcgaatggaagggctggatacgaagt tgggtcttacttgtcattggattatgggcgtcatactctttctttgcaggaacagggaatgaatctaaggatcaataaaa agattcagaaattgatagagcaatacaatgttgatctagaaaagtacaatgaattaatcaggaaaataaacgctaatact aaggagattattgaaaagctagaagaggatagcgcgcttaatgctcgactatcacaagtctccaaagaaatagccgaaaa atcaaataaaccggaagtcgcgcctaagattataataccagaacttgtatatcaatttaaggaggatataagcaaaattg aaccaccaaggtttggattattggggctagatccgaaaaaagataaacggtaccggcttgagctgtgggaaagtacaaaa gaagtgttcctaaaataccttcagaacaataatatccccatttataacaaacttatagaaagaagcagggaaatggaaga attaaagaaaatgactatatccctgtcagagaaagtggaaagaatgaaagaagaacttcttcaaaatgagaaggagctgg aagagagaattatgaattta TAAGGGAAAACTCAAGACAGGTCGTTGATGATGCAGAGGTTTTATTCTTCTTTGGGCTT TCCTCCTAAGAGTTCAAGGCCAATCCCGTTTAGTATCATTAACTGCTCTAAATCGTCCAAGATTTCATTGATAAGGATTC TGTCTTCTTTCTTAGGAGCGTCGAGGTAAAGAATGCGAAGGCGGCGGACTATGGCAGCAATTAGTTTCTTGTTCAATTTT GCTTTGGGAAGCTTTCCGGGCCTGCTGTCTCCCGATGAATTTGACGTTTTAGACTTTGTTTCTCCATCGTCCTCGGAATG TGCACCGAGAAGGGCATCGAGCTCTGCCGGCACGGTTTGATATGCACCTTCCCCCATTACGGCAACCTCCAGCGTCTGAA CGGGTTGTCCTCGAAGGCCACCTCAACGCCACCAAACTTCTCTTCCTTTGTCCCCTCGTCCGGGTTTTGCTGTTTGGTGC TCATGTAAGTCTTTATCCTTGGGTTCATTTTCATAGCGTCC