tg0669

Coordinates:638373-638615

>tg0669 hypothetical protein TGAM_0669
MSEVADFWSWVAQEKAKLDEVLRDREEPPTLIDWLEREITEAREAAFSLKIRGENGAEYWTGYADALEDVLKAIQRREVR
A

>tg0669 hypothetical protein TGAM_0669
atgagtgaggttgcggatttctggagttgggttgcgcaggagaaggcgaagttggatgaagtgctacgtgatagggagga
accgcccaccttgattgactggcttgagcgcgaaatcacagaggctcgggaggcagcgttctctctcaagattcgcgggg
agaacggcgcggagtactggactggctacgctgatgccctcgaggacgttctgaaggccatacagaggagggaggtgagg
gca


Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 637873 - 639115 (Additional range around tg0669 is :500nt.)

>Thermococcus gammatolerans EJ3 ATCCTCGACCCCCAAGAACAGGTCGCAGTCATGCAGCGCTTCTTCATCACGATTGACGAGAACGGCAAGATTCCCGAAGT CATCAAGCCTCTGCAAGGCATCAAGGAGCTTGAGGGCATTGTCCTCTACCGCGAGAACGGCGTGAACGTCCGCTTTGCGA AAATCGTCCGTGAGGACACGCTCAAGGCGGCCAAGAGTTTGAGGGTCGAAGCTCCAAAACCTGCCAAGAAAGGTCGGCCT GCCGTGAAGGTTTCGAGGGCTGAGATTGAGAAGAGCCTCAAGGCTTGGCTAAAGCAGTATGAGCAGTGGGCGTCCAACTG GCGGACGAAGGAGAAGGCAGAGCAGTTCTTGAAGAGTGTTGGCAACAATGGGCTTCGTCGGCTTGTGCGGGAGTATGGTT TCGATGTTGTGGCGGAGGTTGTCGGTTCTAACGCGGATTATCGGGCCCTGTTCGGCCCGTTTCTCTTGAAGCTTCAGGAA AAGAAGGTGGAGGTGAAAGC atgagtgaggttgcggatttctggagttgggttgcgcaggagaaggcgaagttggatga agtgctacgtgatagggaggaaccgcccaccttgattgactggcttgagcgcgaaatcacagaggctcgggaggcagcgt tctctctcaagattcgcggggagaacggcgcggagtactggactggctacgctgatgccctcgaggacgttctgaaggcc atacagaggagggaggtgagggca TGAGGAAGAAGTCGATTCTCGAGATTTGGGAGGAGGTTAGAGACAGCTATGGGAA GGAAGATGAGTGGGCGGCGCGCGGAGTTTACCTCGACCCCGCCGAGAACGACCTCTATCGCGAAATCAAGCTCAGGGAAT ACTACAGAAGGAAGGAGGGTCGCTCATGACGTGGCTCGAAGCAAGAGCTCCAAACTTCTCAAAGTGGAAGCGCTTGGTTG ACCTCAGCAGGGTTGCGGCTTTAGATGTCATTGAGAATGAGAAAAACGCTGTCATTGGCCTTAGAAGCGCGAACGATGCC GAGCTGGCAAAGCTTGTCGTCGAGAAGGAAAAGCTACAAGAAACAATCGACGCTCTCACGCTTCTCATCGAGCAGTCAAA GCAGTTCAGCGACGCTAAGGTCTTCACGCTCGAAGAAGTCCTTCAGGCCAACACTCGCCAGGGGGTGTGGGCATGACTCG CTTTGTTTCTCTTTCTGAAGAACTCGCTGTCAAGCTCGAGTATG