

>tg0680 tRNA (guanine-N(1)-)-methyltransferase

>tg0680 tRNA (guanine-N(1)-)-methyltransferase

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 645005 - 647111 (Additional range around tg0680 is :500nt.)

>Thermococcus gammatolerans EJ3 CCAGAATCCTGTTCTAAAGCGGTAAGAGTAGCCTCGTGTTGTGATTGTGAGAATTCATTTTCAAGTTAAGAAACACTTGG GTTAACTGAAAAATGTTAACTGAAAAAATTAAAAACTCAATGAAGGGCAGCCAATAGAGCTGCCAAAAAAGATATAAATA TGTACAACACCAAGCTTTTAATGGGGGATACACCAACTTCGATATATAGGATTCGTAGTTCTTTCGTTTTGTCTCACCTC CGTCAGATTTTTCAATCTTTTTTCAAGTGTCACCCCTAAATATACCTTGCCCCCTCCAGCTCTGGCGAAATGACAATAAA TTTCAGTACATTTTGCTTAGAGGGTGAATGCGTAGAAAAAGGAGATGTCGGCTAAATCCTCCAACTAATTAAAATCAAAG TTTTGTGACATTTACCAATGTTATATTTGTGCATAAATAACTCATAAACACCCCACAAAAAACCTTTTAACCCCCTACCC GCTTCCCCCGCCCGATGGCC atgaagaccctcgcggacgttttcagggatgcattgagggagaagggcatagagagcat cggaacgctctcgaagcgttttaggaaatccagaaacaagctccaggacattgcgattgagatagttcacggcaagggcg caatcttccgcgtccccgagaagacggcagtcgcgtgggacctgaacgggaatcgcgtcgagggctcttactatgcctac gcacccctctgcatggcggataagttcgagatggttctctcccccgaggagctccgctcaaaacttccggagtggcccta cttcataatcgacctccagctctgggataaacacacccagaaggaaaagggcaaggtctgcctccagattaaccagagct acggccttctgcgcgactacttcacggggcgagagctggcggtaacgtgggcgaacgaggagttccgagggatgttccac ggtccccttgacaggattacagtctatgatggtccaacggccgagtttttgaaggagaagggaatagacgaggtagttct cctcgacccttgggcggacaaggttctgagcgagaaggactttgaggtcagggcctttataattggcggaatcgttgaca caggccacgataaaaagctgacccccaaaattggcgaggagcttgaaagggccggaataaaggttaggcgaaggaagata gtcctcaggggcgacgttgcgggcgttcctgatagaataaacagaatccttggaataatcctcaagatgctcgttgaggg caagtcaatggacgaggccgtttacgagttccaggaaccgcttcacgcacgctggcgcctgaggaaggagcttccgaaga gggcaacccgctacatggtggacgggaagacctaccgcgttgtcgaaaaggagctgttcgacgagtactcaaagtggctc aaaatacgctgggaagactttgttaaagttctcagggagctggacttggtcgcgctcgatagaaagaggattcatcacct aaacaagatttcgaacgcgaggataataaagagtaagctctaccgcgtgattttgctcaaaaaggccgcgatgctctgct acaactgc TGAAGCTCACAGGGACAAGTATCGGAAAATAGGGGGTCATTTTAGGTACCCCCTCCTGATGCCGGCAATCA GTAGAATTACTAACAATGCGAGCCTGAGTGCAAATCTCTGGGCTACTGACAGCTTAGGAAGCTCAACATTGAAGTAAATT ACCGGGGTTGCCAGAATTAGCGTCAGGGCAAGTACCTTCAGCCTATTTTTCCACCACGGCTCGGGGAGTTTGATCTCGCC CTTCCACAGGTCTCTGGCGAAGTTCTCAAACCCCTTCTTGCCTGTTATCAGAATATCAGTGTCCCTTGCTTTCAGCCTTT CAACGACGAGGTCTTTCACGGTGGTGAGCTCTGTGTCATCAGAGTCCCCTCTTTTGGGTTCTTTAGACATCATGATAATA CCTGTATTTGGGATCGCGTAGAAATCACCGAGCAACTTCACAACGACTGCGCTCCCGTACTCTTCGCAAAGACCTTCTAA AATACCTGCCGTGTCCTCTGGTGTGTGG