tg0695

Coordinates:660766-660981

>tg0695 hypothetical protein TGAM_0695
MERVRDVNVRYVMEELERLKVEIQRLEAMLVPIVRGEVSDEELDKIEREARDFKEENWIDADELERILEEDS

>tg0695 hypothetical protein TGAM_0695
atggagcgggtaagagatgtcaacgtgcgttacgttatggaagagcttgagcgcctgaaggtggaaatccagcgtcttga
ggctatgctggttcccattgtgaggggtgaagtatccgatgaagaacttgataagatagaaagagaagcaagagatttca
aggaagagaactggattgacgcggacgagcttgagcggattctggaggaagactca


Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 660266 - 661481 (Additional range around tg0695 is :500nt.)

>Thermococcus gammatolerans EJ3 CGTCTATTATGGTCATTTCCTTTGGTGCGATTTTTACTCCCGCCAGATTAACGCTCTCCAGCTTTATCCCGCTCAGAAAG CCAAACCTGCCCTTTCCGAGGAGTATCTTTCTGATCTCGTCCACAAGGACGGCGGGACTTATTGCCCCACCTCCCGCGGC GTAGAGCCTCCTTGCATCGAGGTAAAGGCCAAGACCGTTGAACTCATTCAGGGCTACCCTTAAGAGAGAGCTCTTTCCTA CTCTCCTGATTCCTATGAGAACGGTTATTGGATACTCCTCGATTCCCCCAAGTAAGGAGTTCAACTCCTTCTCCCTGTCG AAGATTTCCTCCCTCTTGCTCTTCGGCCTCGGGTCAAACAGCATAGGTATCGCCCCCGATACTAAGTATCGGTACCGGTA CTTAAAGGTTCCGAAACGATGCATATTATCATCATTTGAACGAGCGAATCAAAGGGAAAATTAAAATATCATGCCGAAAG AATTCAAAGTGGTGAGAAC atggagcgggtaagagatgtcaacgtgcgttacgttatggaagagcttgagcgcctgaag gtggaaatccagcgtcttgaggctatgctggttcccattgtgaggggtgaagtatccgatgaagaacttgataagataga aagagaagcaagagatttcaaggaagagaactggattgacgcggacgagcttgagcggattctggaggaagactca TGA CTTTCGAGGTCAAAATAAAGAAAGAGGCAATTAAGGCTCTGAAGTCCTTACCGAAGGCTAACCTCAGAAAATTTTTGGAG TTAAAGGACGCGCTTAGATATGAGGCAGTCCCCCCGGGACAAATTTGACATAATTAAACTTAAAGGCTCGGGAGACCTTG ATATTTACCATGTTAGAATCGGCGAATACCGCATTATCTATTCTGTGAACTGGAAGGCCCGTAGGATTCTAATTCACAAG GTTAAGAAAAGGGAAGATGCATACAAATAGCTCAGTGAATCTTGTACCTCAGAAACGCTCCAAGCCCGCCAAAGGCCTTG TAGAACTGCTGTCCCTCCTCGGTGTCGAGGGAAATTATCTCCACGTTTGAACCGGCTTCCTCTGCCATCTTGATGAGCTC CTCCGCGACGTCCCACTTCTCGAAGGTTATGTTCTGACTGCCACACTTGGGACAGTGGGTCAGCTTCTTCTTGTAGACGT GGAATTCCTGCTCGCTC