

>tg0701 Radical SAM protein, elongator protein 3/MiaB/NifB related

>tg0701 Radical SAM protein, elongator protein 3/MiaB/NifB related

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 665255 - 667511 (Additional range around tg0701 is :500nt.)

>Thermococcus gammatolerans EJ3 CCCTGTCCGCTATCTTCTGGGCTATCTTGGCGAGTATTCCAACCGCCCTCGGCTCGGGCTCGATCTCGATGACACCGTAA CCAACGTGCCTGCCGACGTGCTTCATATGGACGGTCGGCTCGAGGTTCGTGTATATCTCCCTCAGGTCGGGAATCTTGAG TATCATGCTGACGGTCTCCTTGACGACCCTCCTGTCAACGTCGAGGGCCTTGGCTATCTTCGTGTAAGGCACCTCAATGT CGCCGGCCTTTATCTTGAGGTCGTCCGAAACCCTGAGACCGTACTTAAGGAGCGTCTTTGCTATAAGCTTCCTCACGGGG TACTCGTCAAAGTAGTGCTCGATCTTTCCCCACATCCTCATCACCCATAGTAGTTCATCACTAACCGTTTTGCATCACTG ATATTAAAATGTTTCCATGTTCACATGCATCCAGATATGACAGTGATGGATTTTTCATCCATCGTTTGCTTTTTAAGTCC CGACCCCGGAACTGGGGGC atgatagagctccgcctgccaaactcacgctttgaggatcttggggatgccatcaggctg atctggcgcgaaaccctctacgcagactttccaaagcgagagcttgagagggtcatcagaagaaagtaccgcgtctcgcc ccaaatcacagcccgaaacggtacactaattatagacactgactacaaaaaagttgaagggtttatagcactatacattc agaacaacctcggtgccctgcttagaaatcggtacaccaaaagaaaagttctttacattcacgaagctcttgacgttcct ctcctcggctacaacgcctttggcctaatagaccggggaacgaacctcatccagataaggggcgtgagcggctgtaacct gagctgcatcttctgctctgttgatgagggcccgtattcgcgaaccagaaagctcgactacgtggttgatatagactact tgatgaagtggttcgacgaggtcgcgaggataaagggaaaaggtttagaagcccatctagacggtcagggagaaccgctc atctatccattccgcgtcgagctcgttcaggccttgagagagcatccaaacgtctccgtgatctccatgcagagcaacgg gacgcttcttacggataaactcgtcgaagaacttgcggaggcgggcctcgacagggtaaacctctccattcactccctcg acccggaaaaagctaaaatgctcatgggaatgaagagctacgacctcgatcacgttctggagatggcggaagctctggta aacgcgggaatagacgtcctcattgctcctgtcataatcttcgggatcaacgacgacgaggcggaggccttcatagagtt cgcaaggaaaatcggcgctggaaagcgctggccggccctcggtttccagaactacgttccctacaagttcgggaggaatc cagtcatagcgaagcccgttcccttcaaggagttctacgcctggctgaggaggcttgaggaaaagacagggatgaagccc ctcgtcctgaagccgagccactttggcatggagaagagggagttcataccgctggcctttcggcccggagaaatagttaa ggccgaggtcgtcctcccgggcaggattgaaggagagatgcttgcaaaggccaggaacaggctcatagaggtcgttggaa cgagggcggaagttggagacaggataagggtgagaatagtgcggacgagacacgggatttacatcgggagggaagtc TA AAAAACTTTTTAAAGTAATTTTTTCGACTATTCCCTGTGAGGGCGTATGAAGCGCTGGTTGGCCCTCGGCATCTCAATCC TTGTGCTCCTATCCGTCCTTGTCGTGACAACCGCCAGTGAATCAACCGTACTATCTGAACTCTCTGGTGAATCCCAATAT GGTGGTTCTCTCATTCCCAACAGCTCCGGCTGGAGGAGCGCTCCGGAGGATCCGCAAACGGTCTACATTGAAATCGTCGC CCCAAACGTCCGGCTTAAGAAGGCCCTTAGAGAGGCCCTCACCAACGTGACCCGCGCCCATAACTTAAAGCCGGTTTACG TCAGCGGCTCAATAGATGACCACGACATGAAAGGCAGAGTCGTGGTAGTTTATCTGCCCCACGCCTTTTCCAGGGACGGT CTCCTCTCCCGTGAGTGCGGTGTTTCGGGAATCCTCTATTACTCCTACGCCGGCGACGCCAAAACTTTCGTCGATATCAT GATGAGCCGGAATACCTC