

>tg0710 membrane bound oxidoreductase, MbxH′ subunit (MbxH2)

>tg0710 membrane bound oxidoreductase, MbxH′ subunit (MbxH2)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 671356 - 674206 (Additional range around tg0710 is :500nt.)

>Thermococcus gammatolerans EJ3 GTCTTCCATATGATCAACCACGCCATAGTGAAGGCCCTCCTCTTCCTGGCGGTTGGCTACGTTGGGATAACCCTTGGGGG GACTGGAATCGAGAAGTTTTCCGGTCTCGGCAGGAGAATGCCCCTGACGGCCTTTGTCATAACCGTCGGTTCGCTGGCGG CAGTTGGAATACCGCTCTTCAACATATTCTGGAGCAAGATCAGGATCCTCATAGCGGGCGTTGAGGCAGGCTACACCTGG GGAGTTGCTTTAATCCTCGGTGCGAGCGTCGTCGAGGCCGTCTATTACATCAGACTGATACACACGATGTGGTTCGGAGA GGGTGAGGGAAGGATCAGGGAGAACCTAGCGATAGGCACGATTGCACTGTTCCTCGTGCTGTTGATACTCTTCATCGGCC TCTACCCCAATTACTTCTGGACGGTCTCCCAGAAGGCCGGTCAGGACATCTTCAACGTGGTTGACTACGTCAAGAACGTC CCGTTGATGGGGGTGGGATC atgacgttcgtcgattatgctatacccttgctcctcttcatacccgcagtcagtggtgt cctcgcatggcttttcgacagggatattgtcagggagatctttggactcatcggtggtctttcgccactcgtgatcatag ccatcacttacggaaagctcggagacggaataaagtggaccgttgacaccggcgttttcaagctgttcttccagcttgag cacatgtcgtggtacctcgccgcggttgcggccgtagttgcagctgcgatggccttcggcatggtctcgacctcgaggag cggctacgagtggatgtttgccctcttcagtgtttccggcctgctgggagtcttcctcagtggggacttcgcgggcttct tcctgttctgggagctcatgaccttcgcgagcttcatgatggtgctccgctacaacaagcgggcctcgcttaagtacttc gtgctcagtatcatcggcgcctacgcgatgctcctggccatagcgatcctctacgccaaaaccggaacgctggagttcca gtccctgcgcaggatggtagtttacgctgcctacggcatggtacccctcacaaagaccgatatggtactagtttacgcgc tcttcctggttgcctttggcgttaaggccggaacctggccgctgcacgtctgggcacccgacgcttactctgagaccaac cagagttacaccaccttcttcagcggtgcattgagcaaggcaggtgcctacggtttcgtcctgatgtttatactcctcgg tgtcaagctctacaccgatcttggaacgttccgcggacatccattgttcacgtacatccttgcctggcttggagccataa cagtcgtcgtcgcgggatttttggcggtccttcaggaagacctcagaaaactcctggcttactcctccgtcagccaggta ggttacatcgttcttgccctcggggttggaagcggaatcggcttcactggagcgttcttccacatcctcagccacgcggt cttcaagggtctgttctggctgatcaccgctgccctgatactcagaacaggaaagacccgctttgaggacttcggcggtt tagccgagaaaatgccggtaacctttgcgatggccctcatagcggttctcagcctcgccggaatcccgccgatggccggc ttcgccagcaagtggctgatctacgaggccgccataagcgctcacatgcccctcgtcgcgggagcaatattcctcggaag cgccatagcatttgcctacgtcgtcaggttcctctacgccatatggttcggtcagaggccgagcgaccttgacgatgttg aggaggcaccgctcccgctcctcgtcggcatgacgatactcgcgataccgaacgtcgtcttcggtatagccccggggctc gtggtaaggttccttaacaagttcataaacactggcgtcgctgtgaacagctactactccataagcacgggcgttggaac ctacaacgcgctcagcgttgctttgatccttgtcgttggccttgccatagcgggtctgatctacatttacggtgcgaggg cgaggaggatacccctcacgaacacctaccaatcgggtaaccccgtcaccgaggactacaacctcagcatgaggaggaac ttctaccggcctctcgccgaagcccttgagttctggctcaagtacagcttcgacaggttctacgccagagtggccaagat agccgaggacttcgccgactggctgagggagggcttctacaacggaaacgtccaggcgtattcatggtacctggcaatag tgctcttgatcctagcactctggggggtgttg TGAATGTTTGACTGGAAGCTCATCCTTGAGGCAATCGGAATGCTGAT CTACGCCACCTTCATGGGCTTCATCTTCATGGGTATCGAGAGGAAGGCAATGGCAAGGATACAGAGGCGCGTGGGGCCCC CGATATACCAGCCAATAATCGATACGCTGAAGTTGCTCGGCAAGAAGGAAAGCGTCAGTCACGGCCTCATTTACGACTTC GGCCCGGTCTTTGCCCTCGGGGCGAGCATAACGGCGCTCCTCTTCCTTCCAATAGCCAATTTCCAGCTCTTCAGCTCGAA CGCAGACCTCATCGTGGTTGCCTACCTCCTGGAAATCCCGATGCTCGGAATAATGCTCGGTGCCATGAGCTCGGGCAACC CCTACTCAGCGGTCGGTGTCCAGCGTGGTCTGCTCACGATGGTGGCCATGCAGTTGCCCTACGGTCTCGCGCTTATAGCC CTCATCCAGCACTGGGGAACCTTCAAGCTCAGTGAAATCGTTGCCCTTCAGG