

>tg0723 Metallophosphoesterase, Calcineurin-like phosphoesterase family

>tg0723 Metallophosphoesterase, Calcineurin-like phosphoesterase family

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 682971 - 685479 (Additional range around tg0723 is :500nt.)

>Thermococcus gammatolerans EJ3 TCTCCTGAGGAAGGGCGCTTCACAGTGGATGAACTCGTTATGGGATGAGGTATCGTTTTATATTTTTGTGACGTATTCCC GCAGGTGATCGCTATGGATATGAAGGCCCCCATCAGGGTTTACATGAGCAGGAAGCTCATAGGTATAAGGCCCGACGATA CCGTTAAGCGGGCCGGCGAGATCATGACTGAGTTCGATATAGGTTCCCTCGTCGTGGTGGACGAGAACGGCGACGTCGTT GGATTTCTCACCAAGGGGGACATCATAAGGCGCCTCGTGGTTCCGGGCCTTCCGAACACAACCCCTGTGAGGGAGATAAT GACGAAGAACCTCGTTACAGTGCCAGCTGAAACGCCCCTCCAGGACGTCCTCGACGTTATGGCAAAGAAGGGGCTGAAGC ACATCCTCATAGAGGAGAACGGCAAGATAGTTGGGATATTCTCGATAACGGATCTTCTCGAGGCGAGCAGGAGAAAGCTT GAAACGGCGATAGCAACGGA gtgatggcgatgataaagatagcccacataagtgacacccacataacgaacgaaggggc cttcaagggctacgctttcgacctcatcgtggaggagatcaacaggggggacttcgatttcgtcgttcacacaggggaca taaccaaccagggactgagggaggagtacgagcaggctgcctatcagctcggcaagataaggaagccgctcgttgttatt cccggcaaccacgacgtcaggaacgtcggctacaagctgttcgagaagtttatagggcccctcaacggggtctacgagtt cgataacggggttctgatctgggtggactcaacgattccggatttgagtgacggcagaatcgggggccataagtttcgct ggctcaaggcaaagctcgaggagtactccgacaggaggttcaagatcgtcgctgcccatcaccacctcgttccccttcca gacacggggagggagaggaacgttctcttcaacgcgggagacgtcctcgatctcctcctgaggcacgaggtgaccctcta cacctgcggccacaagcatgttcccaacgtttatcgcgttgaggatctcgttatcgacaacgcgggttgcacgtcctgcc ggaagacgaggaggggtgatgtgaacagctataacatcatcaaactccacgatgacggcagggtaagcgtcacgataagg cgtgttaccggcgatgaggagaggaaggatcacaagcctatacggccgaaaatctttatcccctctggaaaaagggtcct ccgcatcgttcagttaagcgagagcaacgtttctgacagggtctacttcaggaggaaggtctttgagaacgtcatccgga tgatcaacgagaggcttaaaccggacctcgtcatacacaacggtgacgttgtcgatgcgggcatagagcggtactacgag cgggcctatgagtactaccgcgcgatctctgctgaaaagctcgttgtccccggtcacaacgacataacttacctcggcca cgagctcttcgaggagtacttcggggagccagaagttatagaattcgacgggtacgttataatacccgttctgagcgccc agtacgagacgccgatcggagtcgtcggcaggatgggacagaagaagctggagaaagtgcttgaggaatacgatgacagg ttccgcatcgtggttatgcatcacaacgtcatcccaatccccaggagcagggagatcggcttcctcgaagacggcggaga cgttctcaaactcctgacgagggagggaaccgagctcgtgctgaccggtcacggcggcaacgcttacggagtcaaggttg agagaacgccgatagttaacgccggctccgtgagctgggaactccacagaaatccctttggaaacagcttcaacctgata gacgtttacactgacatggtggtggtctgggaagttcaggcaacgtggggtagcagaaagctcctgggaatatggaagag gaagggcaac TAATCGACCTCTTTTTTCAATCTTTTCATGAGATCTTCCATTATCGCTGTCACGGCCTTCTCCAGCTCG ACGTTTTCAATAACGGGGATGCCCAGTTCCTTGGCACGATCGACGATGTAATCCTGGATGCGCATTATCTTCTCGACGTT CTTTACGTACCTTTCAGCTCCCCTTGGGGAGTATCTGGCCCTTTCGTAGAAGTGTGCCAAAAGGCTCTCCCTGCCCGGAA CGGTTATAACGTACATGAACTCGTTCTCGTCCAGCTCTATGAAACCTGGAACCACGTGGATCCCCTCGATAATGGCGTTC AGACCTTCCCTCCTAGATCTCTCCAAGACTGCCTTGATGCCCACCGATACGTGCTTCACCTGCGTTTCGAAGCCGTAGAT AAGGGGGTCAATGCCCCTCGGCGCGTTTACCACATTGCTTGCCAGGAAGGAGGAGACGTGTATGTCGGGGAGGAGCTCCC TTGCTATGACCTTTCTGAGAACCTCCCTTA