

>tg0728 Asparaginyl-tRNA synthetase (asnS)

>tg0728 Asparaginyl-tRNA synthetase (asnS)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 688014 - 690303 (Additional range around tg0728 is :500nt.)

>Thermococcus gammatolerans EJ3 CCGTGTCCACTCAAGTTCCATCGGCCAGATGATTTTCTCAAGCCATTCCTCAGTGGGCAGGTCTTCGCCGAGCCCCCGGA ACTTCGCCATCGCCACGTGGGTGTGGGCGTTGATTAGGCCGGGGATTACGAGGTAGTTCTCCCCGCCGTAAACCTCGTCA ACGCCCCACTCCCTGAGTTCCTCCACCGGAACGACGGCCCGAATGATGTTGTCCTCGACGATGACTGCTCCGTTTCTAAC GGAACGGTAATCGACGAGCTTCCCGACCAGTGCGAGCATTTTCTCACCGTTGAACATATGGCAGGGGAGAACTTAAATCT TTTGACGTTTTGACATCAAAATGCCCAAAGGGTTTAAATCCCAAAACGAAAAACTCCGACCATGCCCCGGCTCGTTCGGA TTGAGTCAAGGTTAAGGGTCCTGTCACTCTGGTTGAATCGCCTCTTCTGATTGGGTTAGCGTTATAAACCCCGCTGAAAA GCTTTTGGAGGTGGTAAAG gtgattgataaggtttactgcgccgacgttaagcccgaaatggaaggaaagagggttaag ctcgccggatgggtttacaggaagagggaagtcggaaagaaggtcttcatagtgctcagggactcgagcgggatcgttca ggtggtcttttcaaaggagctcaacgaggaagcctacagggaggcaaagaagctcggcatcgagtcgagcgtcatcatcg agggaaccgtcaaggctgacccgcgtgccccaactggagccgaggttcaggcggacaagctccaggtaattcagaacgtt gacttcttcccgataacgaaggatgcaagcccggagttcctgctcgacgttaggcacctgcacctccgctcgccgaaggt cgcgagcataatgaaggtcaagggcacgctcatgcaggccgcccgtgagtggctcctccaggacggctggtacgaggtct ttccgccgatactcgtcaccggggccgttgagggtggctcaacgctcttcaagctcaagtactttgataagaccgcttac ctcagccagtcggcccagctctaccttgaggccgctatatttggcctcgaaaaggtctggtcgctcacgccgagctttag ggccgaaaagagcaggacgaggaggcacctcaccgagttctggcacctcgagcttgaggccgcgtggatggacctctggg acatcatgaaggtcgaggaggagctggtaagctacatggtgcagagaacgctcgagctcaggaggagtgagattgagacc ttcaggaaggatctgacgacgctcaagaacgcggttccgccgttcccgaggataagctacgacgaggcgatagacatact ccagagcaagggcgtcgagatagagtggggcgaggacatgggcgccgacgaggagagggttcttaccgaggagtttgagg ctccattcttcgtctacggctatccgaagcacatcaaggccttctacatgaaggaggatccggaggacccgagaaaggtt ctggccgctgacatgctcgcgcccgaaggctacggcgagataattgggggcagtcagcgtgaggacaactacgacaagct cattcagcgcattttggaagaggggatggatcccaaggattacgagtggtacctcgacctcaggaagtacggttcagttc cgcacagcggttttggattgggcttagaaaggctcgtcgcctgggttctgaagctcgaccacgtccgctgggccactctc ttcccgaggacgccgagcaggctgtatcca TGAGCCCTTTGCTTCGCAAAGCGCTTGCGGAAAGTTTTTGTTCCTTTAT TCTTTCAAGGTTTTGATGGCAGGTTCTGCTAGATCATGCCGTCCTGTAACTACCCCTTCACGACCCTCCATTTTAGCCCC TTTTCGACAGTTGCATCAATGAGACCCCGGTTGTAAAACTCGGCGATAACTGCCCTAACCGGAACGAGGTTCAGGGCGAG CTTCTGGGGCGTTATCTCCACTGAGTAAAGGCGCATAAGCTTGAACGCTATTTCGTCGATTCCCAGGGGGCTTTCGAGAA GATCCTGGACAAGTCTCTCAATCTCCTCCACCCGTTCAAGGTTCTTCATGATTAGGGATCGAGCTTCCTCCTCCACCACC GGCCTGCCGTGAGAGGGAATCAGGAGATAACCGTCATCGGCATAGCGGAGTAGTCTCCCGAGGGAGTCCTTAAACCCGGC CAGATCGACGAAATAGGGAAGGCCAACGGTTTCGAGAACCCTCTCACCGAA