

>tg0743 hypothetical protein TGAM_0743

>tg0743 hypothetical protein TGAM_0743

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 703843 - 705838 (Additional range around tg0743 is :500nt.)

>Thermococcus gammatolerans EJ3 GCATGGGAAAGGAAACGTCAATAATTGAAAAACTCGAACTTATAGTGCCGGGCTTTCACGGCTACAAAAAGAAGGAACTC CTCAGGGAAGACGACAGACTGATAAGGGGAAAGGTGGCCGACCTCTTGGCCCAGGCAAAGAGGGAACTTGAAAGAGCCCT CCAGAGATGTGCGATGGTGAACTGCAACCAGCTGATGGCCATAGAAGGCATGAGGAAGAAGCTTATGATGCTTGAAAGCA GGATCCGGCACGCCGAGGCCGGCTACCGGGGTTACTTTGACAGGGTCAAGTTTAAGGAGAAGGAACTTGAAAGGCTCATC GAGTACGACGCCAAGATGATCGAGCTGGCCGAGGGGATACTTAACGAGGCCAAGGCTTTAAACGCCCAGATCGCCAATCC CCAGGCCCTTGGTATGGCAGTTCTGGGTCTGGATGAGAAGCTTGTGAACCTCGAGGAAGTTTTAAGCCAGAGAATGAGCT TCGCGGCGGGTGAGTGAAA atggtccaggtaatagagtgggttaaccccggagaggacgagataatctggcgctacccc aacgaagtcataaaatggggtgcccagctcatagtccacgagtacgaagtcgctgtgtttatgcgcgacggcaagatcta cgacgtcctcgggccgggaaggcacacgctgacaacgcagaatttacctctcctctacaagctcgtcggcggttcaaaca gcccctttaaggcaacggtaatctttgtcagcatgaagcagttccaggggcgctacggcggcgaaacgcagacgagggaa ctggcgcccgtcaagtactacggcgtctactggttcaaggtcgccgatccggttctcttcatcactgaagttgtcggcgg ccagagcctctacgacgcccaggacgttacaaagttcatcagggcatacttcaacgagggcatgatgaagcacctctcta cctactcaatagtcgatctcttccagaacctcgacgtggtcagcacgcaggtcaaagttaaactcatggaggacttcagg agactcggccttgagctcgttgacgttaaaatcgagggagtaaataccaccgacgagtggcgtcagaggctcttctggct aatgcagactggcaacgctcaagcggttatgcagatggacacggtgaagcaggtcgcggccgagctcggcaaaagtcccg gggccggtatgggaaccgggatggtactcgtgccgcagctcttccagcagcaggcccagccgattccaccggcccagccc tacgcgggtgggggcacccctccagcaccacagcaaccccagcaagcggcacctgcccagacccaacagcaggaaatctg cccctactgcggcaagccgattccaccgggggcgcgcttctgtccctactgcggccatgaaatcaagcgctgtcccaacg gccacatagttccagagggagcgaagttctgccctgtctgcggtgcaaagattgag TGATGGTTTTTATTTATACTTCC CTTTTTGCAACTTCTCTGCAAGAGTTCGCTTTGGGATCTCTGGTATTCCTCCAGGCTTATTCTCAAGACTTACACTAAAC AACGACGACTTCACGAAAAGGGTAGAATGGGAGAAAAAGTCAGGCACACCTCTCCTTGTACTCGGAGCTTACCTCGGGCT TCTTTTCCTCCGGCTCCTTGAGAATGATCCTAGCGTCGACTATAACCGCGCCCTTGCCCTTCTCGTAGACGAAGACCGGG TTGAGGTCCATCTCCTTGATGTAGTCCCTGAGCTCATCAACCAGCTGGCTGACCTTGAGAAGAAGGTCAACGATGGCGTC TATGTCGGCAGGCTCCTCTCCACGCGCCCCCGCGAGAATCGGATAGCCCTTGATTTCCGTTATCATCTTTCTGGCGTCGC GCTCGGTTATCGGGATTATGCGGAAGGTGACGTCCTTGAGGACCTCGACGAATATTCCGCCTAGACCGAACATTATC