

>tg0751 IMP biosynthesis enzyme (5-formaminoimidazole-4-carboxamide-1-(beta)-D-ribofuranosyl 5′-monophosphate synthetase) (purP)

>tg0751 IMP biosynthesis enzyme (5-formaminoimidazole-4-carboxamide-1-(beta)-D-ribofuranosyl 5′-monophosphate synthetase) (purP)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 710729 - 712868 (Additional range around tg0751 is :500nt.)

>Thermococcus gammatolerans EJ3 GCTTTCCAAAGGCGGGCCGGTTCTCATAGAATACAACGCCCGCTTCGGCGACCCAGAGGCAATAAACGTTCTCCCTCTCC TCGAGACGAGCCTGCTTGAGGTTGCGGAGGGAATAGTTGACGGCAACCTTCAGGGAGCGGAGTTCGAGAAAAAGGCAACG GTCGTCAAGTACCTCGCGCCGAAAGGTTACCCAACGAACCCAGTTAGAGGCGTAAAGGTGGAGGTCAACGAGAAGGCCGT TGAAGAGGTCGGTGCAAGGCTCTACTACGCTTCAATTGACGAGAACTTCACTCTCCTAGGCTCGAGGGCCATAGCGGTCG TTGGAATCGCCGATAGCCTTGAGGAGGCTGAGAGGATAGCCAAGAGCGTGATTCCGCACGTAAAAGGCGAGCTGTTCTAC AGGCGCGACGTCGGAACCCGGAAGAGTGTCGAGAAGAGGATTGAGCTGATGAAGGAGTTTGGAAAGGAATTCGAGCCGAA CCCGTGCTGAGGTGATGGGA atgataagccgcgatgagattctgggaatactcgagaggtacgaccccgagaaaataac cgttggcgtccttggaagtcattcggctctggacatagccgacggtgctaaagaggaaggtttgcccgttctcgtcgtcg cccagaggggcaggcacaaaacttacgccgagtacttcaggctgaggaagacgagggacggcataaccaagggcttcatc gacgaggtcatcgtccttgaaaagttcgcccggataatagacgtccaggatgagcttgttaagaggaacgtcatcttcgt ccccaaccgctcttttgttgtgtacactggtatagacagggttgagaacgactttaaggttcctctcttcggcagcagga acctcctcaggagcgaggagaggagcgaggagaagagctactactggctccttgagaaggccgggctcccatatccggaa cctgtgaagccggaagagattgacgaggtcggcctcgtcatagtcaagcttccgcacgccaagaagaggctcgaacgcgg attcttcacggccgcgagctacaaggagttccgcgagaaggctgagaagctcatcaagctcggcgtaatcacggaagagg acctcgcgagggccagaatcgagcgctacatcattggaccggtgttcaacttcgacttcttctactcgccgatagatggg gaaatagagcttttgggaatagactggcgctttgaaacgagcctggacggtcacgtaaggcttccagcggcccagcaact gaccctccctgagtggcagttcgaacccgaatacaccgtaacgggccatgcatcctcaacgctccgcgagtccctccttg agaaggtcttcgatatggccgagaagtacgtgaaggcgacgcaggagtactactctccaggcataatcgggcccttcacg ctccagacggcggttgacaaggacctgaacttctacatctacgacgtcgccccgagaaccggcggcgggacgaacatcca tatggcgatgggtcacccctacggaaacgccctctggagaaagccgatgagcacgggaaggagggttgccctcgagataa agcgcgcaatcgagctcgacgagcttgagagggtggtgact TAATCACAGTTTTAATCTTTTAAGACGAAACATTTTTA ACTTACAATGCGTAAAGAAGTAGGGCAATTTCAATGAGAAAAGTTGTGGGGGTTCTTTTACTAATCGGATTGATTGCGAC AGTTTGCGTGTTCTTCACCCACAGTGCTCATTACGGGAAGAAAAATAATCCCATAGATTTCAGGCCAGTTTACCTTTCCA ACGTTTCCCTAAACGCCAGATTCTCAAACGAGGGGCCGGGGATTCTCGTTGTCCAGTACTCTGACATTGAAAAGGCACCG ATTAACTTGAGCAAGCCGGTTCTTGTGGTTGGAGAGATCAACGTCACACGGCTCTTAATTACCTTCAACATAACGACACC GCTTGCTTCCATTGAACCTTCCCCCAAGGCCGTCTTTGTGTACAACAGAGGGTTACTTTTCCTCGAATCTGGAGATGTGA GGAAGTTCCTTGTCTGGACTCGCGAAGTCATACGATATGAAGCCCACTGGAGCTTTGGAAT