

>tg0800 M42 family glutamyl aminopeptidase, de-blocking aminopeptidase

>tg0800 M42 family glutamyl aminopeptidase, de-blocking aminopeptidase

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 755960 - 758003 (Additional range around tg0800 is :500nt.)

>Thermococcus gammatolerans EJ3 CGGCTCGATAAAGGGGATTGGGTTCATACACAAGCGGGAGTACCTTGGGGAAACCATTGAGAAGCTCAGGGAGGAACTTC GGAGGCCCTACGACCCCAGGAGAGCCCTTAGGTTCCTTCTAAACGAAATCTACGTGAGGGAGAAGATTGACTTCGGCAAG CTTGTTTCCCTGGAGCTGGCGAAGAAGCACACGTGGACCAACATCACCGGCGGGAGCAGGGAGGCGACGGTGCTCTTCTT CACCCCGCCGAGCACCTCCTACGAGGTTCGGTGCGAGGTGGAGGTACATGAGGGGGATGAGGTCTGGGAGTACACGAACG CGGTTCACGACGTCTTCCACAGGCCGAAAAAGCCCCGGGACTGGACTAAAACGCCCGCCTACCTCTTCAAAATCAAGGAA ATATACGACAACGGGGAGCGGGCAATGGGAATCAGGATATACCCTTAGCACCTAAACCCTTAAAAGCTCATTACGATGAC TGTCTAAACGGTGGTACCG atggtggacttcgaactgctgaagaagattattgaagcccctggagtttccggctacgag ttcctcggcgttagagacgttgtaatcgaggccttcaagccctacgttgacgagattagggtcgacaagctcggaaacgt catagcgcacaaggaaggaaagggcccgaaggtcatgctcgcggggcacatggaccagattggactcatggtgacccaca tcgagaagaacggcttcctccgcgttgcgcccgttggaggtgttgacccgagaactctcatcgcccagaggtttaaagtc tggattggcccgaacgagttcatctacggcgtcggtggaagcgttccaccgcacattcagaaaccggagcagaggaacaa ggccccaacctgggaccagattttcatagacataggcgccgagagcaaggaagaggccgaggagatgggtgtaaagatag gcaccgttatcacctgggacggtcgcttagagaggctcggaaagcacaggctcgtcagcatcgcccacgacgacaggata gccgtttacaccctcgtcgaggcggccaggcagttaagcgagaccgacgcagacgtttacttcgtcgcgaccgttcagga ggaggtcggccttaggggcgcgagggtttcggcgttcggcattgacccggattatggcttcgccctcgacgtcaccatag cggccgacgttccgggaactccggagcacaagcagataacccagctcggaaagggcgtcgcgattaagataatggaccgc tccgtcatctgccacccgacgatcgtcaggtggatggaggagctggctaagaagcatgagataccctaccagtgggacat cttaacgggcggaggaaccgatgctggagccatacacctgaccaagagcggcgtcccaacgggcggaataagcattccag ccaggtacatccactccaacacggaagttgttgacgagcgcgacgttgatgcagccgttaagctcacggtcaaggttctt gaggagattccggagcttaagctc TAAAGCTCCATAATTTTTCTTACTTTCTTTTCAAGCCTCTCTTTTCAAGAGGACT CAGTCTATGCTACCCGTTCAATCCCGAGTAAAAAGAAAAAGGAATCCGTGGTCGGTGCTCTTAAGATATCTCATTCTCCC TTTGGATCCTGTGCAACAACACCTCAAGCCGCTCAATCAAATCATCACTAACAGGGATCCCTTCCTTTAACCGCACCTCC ACCTGATTTATCGCATTCAACAAGTCATCCAAATTCTCCCGCGTGTAAACCTTCAAATCCTCCAAAGCATTCAACAACCC AACCTTATCATTAAGCCGAGCACTCAATACTGCTATCCTAGCAGTCTTCTCAACAGCCTCCCGCCTAAGCATCTTTATTT CCCACATAGATTTGCTCCTTTTGAGACTCCTCTTCGTCTTTTTCAGTTCCTTAAGCTCCCACTCCAACTTTCTAAGAATC TCTAGTGCTGCTAAGAACTCCTCAACACTCTGGTAGCGATCCTCC