

>tg0815 Mannose-6-phosphate isomerase/mannose-1-phosphate guanylyl transferase, bifunctional enzyme (manA/manC)

>tg0815 Mannose-6-phosphate isomerase/mannose-1-phosphate guanylyl transferase, bifunctional enzyme (manA/manC)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 765923 - 768317 (Additional range around tg0815 is :500nt.)

>Thermococcus gammatolerans EJ3 TCGGTGAGTTCGGGGCGAAACGCGGAAAGTACCGCGTGGGTGAGCTCGGGAAGCCATATCCAGAGATAAAGCGCGCGCTC GACGGCCTCTCCCGGAGATACGGCCTCAAATACTACGGTAACTCGACCCTCGACGAGGTTAAGGCCTTCACGGGCCTGCC CGAGGAGCTCGCAAAGCTCGCGATGAAGCGCGAATACAGCGAGACGATATTCAGGTGGGGGAAGGAAGGATTTGAGGCGG AGCTTGAAAGGGTGGGCCTTAAAGTAAGCAGGGGAACGAGGTTCCTGAACGTCACCGGCAACACCGACAAGGGTAAAGGC GCCAGAGCCCTCCTCGAACTCTACTCCCGCCTCGGCGAGGTTGAGAGCTACGCGCTCGGAGACGGTGAGAACGACTTTCC CCTCTTCGAGGTCGTTGATAACGCCTTCATCGTTGGGAAACTCTCTCATCCAAAGGCTAAGCATATAAGCTCGATTGAAG AACTCCTGGGGGTGATACC atgaagaccgtaatccttgccggaggaaaggggacgaggctgtggcccctgagcagggag ctgatgccaaagcagttcatccgcttcctcgacgataggagcctcttccagaagagtgttgagagggcacttctcttctc gaagccgggcgagatattcatcgtaacgaacagggactaccgcttccgcgttctggacgatttaagggagctaggcattg agattccagaggacaacatcctccttgagccgagcgctaggaacaccctgcccgccattctctgggcgacgctcaggata gaggaggagttcggggactcggtcgttgcagttctgcccagcgaccacctcatagaggtcaacgaggcctacgaaagggc ctttgagaacgccgaaaagcttgccaaggaccacctcgtcaccttcggaatcaagccgaccagacctcacactggctacg gctacataaagccgggcgagaagattgaagaggacggaaggataatcgggtacaaggtttcagagttcaaggagaaaccc gaccttgagactgcaaagcgctacgttgaaagcggttactactggaacagcgggatgttcgcgttctcgagctcgctctt catcgaggaagtaagaaaacatgcccccgacgtctgggaggcctttgaggagagcggtgacatagaggaggcctacaacc gcgtccctgagataagcatagactacggcgtcatggagaagacagacaaagcagctgtggttcccctcaacacgaagtgg agcgacctcggcagttttgatgcaatctacgaggttcttgagaaagacgacgacgggaacgccgtaagggttcgcggaaa gaacggctaccacataggggtcaactcgaagaacaacctcataatgaccgaaaggcttaccgcgactgtcggcgttgaag acctgataatcatagacaccggcgatgcattactcgtggcgaggaagggcgagagccaacgcgttaaggaggtctacaaa gctcttaaagagctcggtgacgagcgcgtcattgtccacagaaccgcctacaggccctggggaagctacaccgtccttga agagggcgaccgctacaagataaagcgcctgaccgttctgccgggcaagaagctctccctccagatgcactaccaccgct cggaacactgggtcgtggtcagaggaaccgccaaggtcatcgtcggggacaaagagctactcctgaggccaggtgagagc accttcattcccgctggagtcaagcaccgccttgagaaccccgggaaggtggtccttgaggtcatagagactcagattgg cgagtacctcggcgaggacgacatagtaaggtttgacgacgatttcgggagggca TGAGGGTGAGTGACAAGAACTGTT CGGACTCATGGGAGCGTTTCAGCTCCTCCATTTCCTCCCTTTCATTGAACCTTTTACCAGCGCTGCTTTTCGTGCTCATA ATGTCGTACCTCATCACAGGCAACCTGGGTGAGGGGATAACCCTGAACATCAACGGTCAACAGGCGAACATAACTTATCC CCCCACTCAGATCCCGATAGACTATGCCGCAATAAAGACAGCCGTTCTGTACCTCTTTGGGGCAATCCTTATAGGCCTCC CGGTTCCGTTGTTCTCGGGGAAGTTCAAGCCCCTGAAGATACTGATCAGCATCGTCCAGGCTGGTGCTTTCGTCTACGGG CTCTACATTTTCGTCTTCATGATAATAAAACTCGCAAACTCATTAACGTGAGGTGGTGGACATGGGAAGGCTCTTCGGAA CCTTCGGTGTTCGTGGGATAGCCAACGAGAAGATAACCCCGGAGTTCGCGCTCAAGATGGGCATGGCCTTCGGGAC