

>tg0838 Sodium symporter, putative arsenite efflux pump ACR3

>tg0838 Sodium symporter, putative arsenite efflux pump ACR3

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 786949 - 788953 (Additional range around tg0838 is :500nt.)

>Thermococcus gammatolerans EJ3 TTCGAGGCGAACGTGCCCGAGACGCTCCACGTGCTCAGCGTGGAGGCCGTGGTGGGCGGCTTCCTGGCCTTCCTGTACGG AATGGGAAGGCGCATGGCGAGAAGGCCCTCCCCCGCCCCGTGACCCTTTCGTTGTTTGAGCAAAAAGAAGGAGGTGGTTG AGATGCCGTTCGGTGTTCCCGGATGGAAATGGAAGGTTGGAAGGTTTGGCTACGTGATGGGAAACGAGCCGAGCTACGAG GAAATTAAGGCAAAGGCGAAGGCACTGCTCGAGAAGGCCACGAAGGGGCCCGCGTGGCACTGCCGCTGCGGAACCTTCCA CGTCCCCCTCCTCGTTGACGGGGAGATAGTCGGGGAGCTCTGGGAGGACGTCGAGCCGAGAGAACTCGAAGTCGGCGCCT ACTGGCACGGGAAGTGGGGGACGAAAGTCCAGCTCGTGAAGGACGGAAGGGTGGTGGGCCTCCTATGGCTCGCCTGAGCC TTTATTTTTCCAATGGGAG gtggttgagatgaaaattgtgaagttcctgaaggataagatgatttacatcgtcttcacg ctcattatcctatcgagctacgccggcgttcatcacagggatgtcttcctgtccctcaaatggacgctgccgattgcact cttcatgatgctcttccagccgatggtcttcatggacataaaaaaggcatttgcgacgagaaccgagataaagacgaagt atctcatagctgtgacggccttctacgtcatcatctttccggctttaacgtggcttctcatcaagttctggctcgcggta atgccgaacaccgacccgaggctgctcgctgggatcgtgctgataagcctcgctccgctcccgagctcggctccagcatt cactaacctcgcgggcggaaagttccagctgacgctcgtcggcgtcgtgtggacgttcgtcctctcgctcttcgtcatgc ccgtctacgctaagctgctcctccacacactcataaaagtccccacgtggctgctcctcaagtcgctcgtcctctacatc atagtgcccctcgtggcgggccagctaacgaagtacgcagttctgaggtggaagggaaaggatgccctcatgaagctcaa ggagcccctcgtgggcctctcgctcctcggcatgtactggatgataaccgtggtcttcggcataaacgggaagattatag ccgagaagccggaggttatagtcgtcggagcgctcataatgaacgcatacttcctaacgcgtgcggccatagcttacttc accggaaaagcgcttggctttcctctggagcacattatatcgctcgtgtattcaaccggttccaacatgaccctcgcgac ggcgatggcaatagggacgtttggtcccctcgcggccgttggaacggctttaggaggccccttcagcgacatgatactca tgatactcttcgtaaggctcttcgccctactgagggcaaagagcgtgtctggagaagatgaaacc TGAGAAATACCGGA ACTTAGAGAATGCTTCCCCAAAGGGTTTTAACCCATGAACCCTACTTCATCCGGGTGCTGAAAACATGAAGGCCATAGAA GTCGTCGGACTCACCAAGTACTACGGCTCCTTTCTCGCCGTTGATAACGTGAGCTTTGAGGTTAGGAAGGGGGAGATCTT CGGTTTCCTCGGCCCGAACGGGGCGGGAAAGACGACAACAGTCAGAACGATTACCGGTATTTTAAGGCCGAATTCAGGAG AGATAAGGGTTCTCGGCTACGACATGCTTGACGAGAGGGAAAAGATAAGGGCGAGGGAGAGGACGGGAATAGTCCCAGAG ATGGCCAACCCCTACGTGGATTTAACGGCGATGCAGAACCTCAGGCTCATGGGCGAGCTCTACGGGATGGGAAGGAGGGA GATAGAGAGGCGCTCGGTTGAGCTTCTCAAGCTCTTCGACCTCTACGAGAAGAGGAACGTGAAGGTAAAAGCTTTTTCCA AGGGCA