

>tg0843 C4-dicarboxylate transporter/malic acid transport protein (TehA/Mae1)

>tg0843 C4-dicarboxylate transporter/malic acid transport protein (TehA/Mae1)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 790175 - 792176 (Additional range around tg0843 is :500nt.)

>Thermococcus gammatolerans EJ3 TGCACAAAGCTTATATGAGAAAAAAATTTCAATTAAGCGGGGGATGTGGCATGAGGATAGCGGTTCCGGCTGTGGATGAC AGAGGCTTAGAAAGCGAAGTTAGCGGGCACTTCGGCAGGGCAAGGTATTTTGTTTTCGTGGACGTTGAAGACGGCGAAAT AAAGGATTTCGAGGTCGTTGAGGTTCCCTTCGAGGAGCACGGGCCCGGCGACCTTCCGAGGTTCGTCAAGGAGCACGGCG GGGAGGTCGTCATCGCCTACGGAATGGGTCAGAGAGCTATCTCATTCTTCAACGAGCTCGGCATAGAGGTCGTTACTGGT GCCTATGGAAAAATAAGGGACGTTGTCGAGGCGTTCATCCATCAGGTTCTTGAGGTTGATCCCCACTGGAAGGAGAAGAT AGAGCGCGAAAAGGAAAGGGAAGGGCACCGCCACTGAGTTTGGGAGGCGTTCAGGAAAGTTTTTAAATTTTTTTCATATG AGTTTCCCCCGGTGAAGCAG atgaaggtgagcgtaaaggacttcgcaccgagctggttcgcgagcgttatgggaacggg agctctcgctttggccagcaaagcttattcatcgaggattccggccttaggtggactggcggagtttctcgtctacttca acacgctcctgttcttcatcctcctaatcccatggctcctcaggtgggtgaagtacacggaaaacgccctggaagacctc aagcatccaatggtgagccacttctacgggacgatagccgtggccatgctcgtactctcggcggattacctcttcatact caagaagactgcaatagcgaaggcgttctggattccgggagcagttctaacgatattctttgccctgctcatcccctacc tgatgttcgttgagaaggagatagacctaaagtccgttaccccggcctggttcattcccccggtcggcttaatcgtgatt cccatgagcggcgcggctttgatatcgagcttctcgggaacgtttagggaggttgcctacgcggtcaactacttcgcctg gggtgcgggcttcttcctctacctcggcctcttcgcgatagtcttcttccgcttcataaggcacgagccgatgccctgcg gtatggccccagcggtgtggataaacctcggtcccattggagctggaacctcaacgctctacgcgctcgttaaggccagc gacttccttactgtcaaagaaccgttcttcgcctttggcttaatcctctggggcttcggcgtctggtggctggcgatggc catcataatgaccctatactacatcaggaaccttcgcttgccctacagcctcgcctggtgggccttcatcttcccgctcg gggcctacgtgggggcaacgcacaacgttggcacggcctttggcataggggtaatagacggcttcggcttcgccctctac tggcttctcctcaccatatggctggtaacgggtttgaaaacagcaaagcacgtgctcctcgaa TGATTTTCTTTTTACC ATTCTCCGAGGAGGCCCTTTATTATAAGCTCCGCCGCCTCGTCCTCGGTCAGGCCCTTGGCCATGAGCTGGATGAGCTGG GCCTCGTTTATCCTGCCTATCGAGGCCTCGTGAGTAAGCTCGGCCTTCTCGTTCTTCACCCTCAGCAGGGGAACTGTCTG GACGTCGGCGTCGCCCTTAACTATTTCGTGGCACTCGACGTGCCCCTTCGCGTAGTCACCGAAGCCATAGGCCTCGTTTA TGACGTTTACCTTCGCCCTGTCGAAGGCTATTGCCGTGCTCCTCAGGTTCGCCCTCGAGTGGGCTCCCTCCAGGTAGGCG ACTTCCTTCATCTCAACACAATCATCTTTAACGGCCTTGACCTTCGTCTCAAGCTCGAGAACAGCCCTCTCACCGAGCCT CGCGACCATCTCAAGCTTCAGCTCCTTTGCTCTATGTTTCGTCAGGGTGAACTTCCCCGTGTAGCGGGCGTTTTTGCCGA CCT