

>tg0848 C4-dicarboxylate transporter/malic acid transport protein (TehA/Mae1)

>tg0848 C4-dicarboxylate transporter/malic acid transport protein (TehA/Mae1)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 794271 - 796281 (Additional range around tg0848 is :500nt.)

>Thermococcus gammatolerans EJ3 TCTGGGCCTGAAGAAAATCATCATCGTGCCCGAATAGATGAGAAACGCGACAAAAACCCAGAGGACGTAGACCTTGGGAA TGAACTTGCCCGCGTAGGCTCCAACAGGGGCCATCGCCGTTGCGACGATTAAAATCGGGAGCCCAAAGCGATGGTCGAGC TTCCCGTGCTTTATGTTCTTGAGAGTTGCCGAAAGCATCGAGAGCGTGTTTATGAAGAGACCAGTGGGCTTGGCCGTCAT GAGAGGTATTCCAAGCCAGCCCATAACCGGGACTATCGCTATCGCTGAACCCACCCCACCGATTGAAAAGACGATGCTCA GGATGAAGGCTATGAGTGCCAGCTCTGGGTAGTTCATTAGACTCACCTCATTTTCTTTTGCCACCCAAATGAAAGAAAAG CGGTTTATAAGCTTTTGTGTCCGGTGAATCTAACACATCAAATATTTTGGGACCAAAAATTTTTAAGCTATCCTAATTCT GGATTGAAAAAAAGTAAGGG atggatgatcatatggagagagctaggaacttcaatccagcgtggttcgcgagcgtcat gggaaccggtgcggtggcaattgcctcctacaagtactcctcatactggagccccctgaaggaagtgggaatcgccctga cgtacctgaacgtcgtcctctacgtagctctactcatcccgtggattctgaggtggattctatacaggaaggacgccttg gaagacctcaggcacccatcaaaggggcacttctacggaacgagtggagcggccacgattgttttagcggcccagttctt ggcggtactgcacaaccagactgtggcgtggtacctctggctctgggggcttgtcctgacgttcatcttcgcgttctgga tgtcctacgaggttttcatagcgggtgaagttgacctcaggcacctctcacccgcctggtatatcccgcccgttgccctc gttatactccccttcggggcggccttcatgagaacgacaaagggctacactcaggaattcgtcacaatcgttaactacct cggctggggcgcgggtttcttcctgtacctcgtcctctatgccgtcgtgacgctccgcttcataaggcacgagctgatgc caccgcagatggccccgctcatatggatgaacctcggacccatcggagccagcatcactgccctcttcgccctcgtgaac aactcgagcatagcgacctcgaaggacccgctcttcatcttcgccttcttcctgtgggggctcggcttctggtggctggt tatggcggtggccttaactctccactacatcagaaacatgagcctgccctacagcctcgcctggtgggccttcatcttcc cgcttggagccttcacaaacgcaacaatggacctgggaagcgtcttcgagcttgagctgatgaggctcttcggctactgc ctgctatggttactgctcgccctctggtcggttaccttcacaaaaactttaaagatgggcctcacgagctcg TGAGGCA CTCGCTTTCCTCCTCTTCCAGACGGATTATGCGTTCAAGGACGCACTCAAGCTTTTTCAGGTCGTTGAGAATCGCCTCCA GCCTGCCTCTCATCTCGTCGTCGCTCTTTTCAATCATGGCCTCAACTATTTTCTCCAGCGGGCGAACCTCGCGTTCAAGT GTCTCCCTCGGCTGGCGGAGGAACTTCTCCAGAAAGGCGGGAACCGCAGTGAAGTACTTCGTCCTGCCTTCCCTCCTGCA GGTTACGAGGTATTCCCTGACGAGACGGCTTAGGGCGACGGATATCGAGGAGCGGCTCAAACCCGTTTCTTTCGCGAGCT CGGCTATCGTCATCGGTCTGTTAGAGAGCAGTAGGATTGCATACACCTTTCCATCGGTCGCCGTGTAACCCCAGCGAACC ATGATTCGCTCGACGATCTCTATGAACTTCCTGCGCTCCGTTCTGGCCCTCATCCACATCCCCCTCTAAAAATCGAAAAA GAACTTATAAAT