

>tg0851 Predicted Fe-S oxidoreductase, containing Elp3 domain

>tg0851 Predicted Fe-S oxidoreductase, containing Elp3 domain

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 796286 - 798959 (Additional range around tg0851 is :500nt.)

>Thermococcus gammatolerans EJ3 GGCACGAAAGCAGAAAACTAAAAGGAACCGGGATTCATTCCTTGGCGGTTGCTATTATGATTCCGCCTATCAGGGCGACA ATTGCGCCTATCAACCAGAAGCCACCGTCGAAGGGCATCGTTATCAGCGCTAAAATCACTACGCTCCATCCCACAAGGCT CTTGTTGCTCTTGTAGTAATACGCCAGGCCCATCATCATCAGGCTGAGGATTATTTCTACCCAGCCGACAGTTGATGCGC TACCGTAGTGCCAGCCGTAGAAGTTCCCCGTGCTCAGGACAGCTATTCCGTCTATCAGTATCAGAAGGGCACCCAGCAGG GCGGTCCACATACCGGTTTTCGCAGAGGCCATGGCTTTCACCTCCCAAAGTTCTTTCAATTAACTGTTGTCTACCCGATT ATTTAAATTTTTTGGTTATGTCTAACATATCAGAAAAAATCGACATAAGCTATAACTCTTTTATGTCGAAACCTTTAAAC GCAATGGTGAGTACCACATA ttgggggtgagatacatgaaggctccaaaaacgataaaagaacccttcccaaacgctat gaatccctcggtggatgtggaggaggctgaatccgaagaaggtggaagtcaggtgaccaccgcgctgagggccttcaagc tcatccttggaaatcccctggctagggcactcataaggccgagcctcaaaaagtacaaaatcaacgggcgcgagcttcca gctttatactgggcgctcagcatctacgcgggcgagagcataaacgcgccgatgatggttcgcttccaggcggacacgat aaagctcctgctcaagctcggcataaagctcgcccacggcgacgaggaggccgccaaggaagcccttctgcgtgacccgc acataaggcgtggaatctgggtcgtccttgagggcatagcgaagtacggagtaaccgttccccagcgccttgccgggccc ttcctgatagtgtggaacttcaccaacatgtgcaacttcaggtgcaagcactgctaccagagagcagacaggccacttcc aagtgagctcagccttgaagagaaactgaatctagttgaccagctcgacaaagccggtgtcgcggcggttgcgataagcg gcggtgagccgacgatacacccgcacttcctcagaatcgtcagggagctgtcgagcagggggatacacacctcggtcgcc acgaacggctggactttcgccaggaaggaggagcttgagaaggcagttaaggcgggaataaagtatgttgaggtcagcgt tgattccgcaaagcccgagaagcatgacgagttccgcgggattccaggggcgtgggagcacgcggtaaaagccttagaaa acgcggtcgaactggggctcagccacgggatggccacgataatggacaaggaaacctatcaggagatagacgacatactc gacctggcggagagcataggcgtcaagcgtgtcatattcttcaacctcgtgccgacgggaagggcagaggacatgattaa ggtggacctctcgccggaggagcgcgaggagttcatgaaggaagtctaccgccagatgaagaagaggaagcttgagatac tcacaacggcgccgcagtacgcgcgcgttaccctgctcatgagtcagggaaagagcgtcacgccggcgcacttctacata ggcgagaacaacgccgtgaaaactctcgcagagttcataggggggtgtggagccggaagaatttacgcggggatagagcc cgacggaagcgttgtgccgtgtgtctttctcccactgccagtcgggaacgtcaggcacaggccgttcaaagagatatggg agaacagcaggatattcaacatcctccgcgacagggacagctgggagggccagtgcggaaagtgcccctacaagtacatc tgcggcggctgtcgcgcgagggcctaccactacacgctcgacttgaagggcgatgacccaggatgcatcataaacaagcg tctctgggaggaaatagtcaaacacggcaagccgaaggggctcacagaggtcaactgggtcgatgagacggtagttctcc gcgggccgagcctctacgtgccgagctactacagggcggttgagcacatcgccgaaaaattgattgaaatcggagaaaag caggaagttcacgcc TGATTTCTTTTCCTGAAGTACTTTCTTCCCTTTACCTCGACCATCCTGTAGACCTCACCCTCAC CCAACTCAAAAGGTGGCCGGTTGAGCTCGTACGTTTCGTAGCTCTCCATGTCCATCATCTGAACCTCGTCACGCCCTATG CTCGTCACCATCGCCTCGCTTTCCTCGTGCTCAACAGTGTCCACCTGCTCCCTTTTCGCGGTTTTCCAGTCGAGGTGCTC GCTCTCCCAGTTCTCGAGGTTCTTGAGCGTCAGGCCCTTGCCGTCAACGCGCTCAACCTCGTAGACGTTGCCCCTTCTAT CGGCCACGATGTCGCCCTTCCTGAACTTTGGCAACCTAACGCTCACGCTCGTCCTGTAAACTTCCCTGCTCGTCTGCCTG TCGAGACCAACGAGCTCGTAAGCCTCGCTTATCGTCCCGCCAAAGCGCTCGCGGATTGCCTGCGCTATCTTTCTCGCGGA GCTCGTGGAGCCCATGTAGAAGTCGAGGCCTTCCT