

>tg0857 Potassium uptake protein, TrkH family (trkG/H)

>tg0857 Potassium uptake protein, TrkH family (trkG/H)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 802061 - 804527 (Additional range around tg0857 is :500nt.)

>Thermococcus gammatolerans EJ3 GCCTTCGCGACGTCCCTGACCATGACACCGGCTCTGACTGTCGCTATGGCGTTCTCGAGGGCCTCCCTCGCAGCTTCCAT CAGCTCGTCTTCCCCCATCCCAACGCGGAACGTCACTGCAGTGTCCGCTATGTAGCCGTCGACGTGGACGCCGAGGTCCA GCTTGAGGTAGTCCCCCTCCTTGAGAACGCTCTCGTCGCCCCGATAGGGGGTGTAGTGTGCCGCAATTTCATTGAGCGAG AGGTTGCAGGGGAAAGCAGGCTTTCCCCCAAGTTCTACTATGCGCTTCTCAACGAACTCCGCTATATCATAGAGCTTAGT CCCTGGTTTGATAAGATCAACGACCTCTTCCTTGACCTTTCTCGCTATTTCACCAGCCTTCAACAACGCTTCTATTGCCT CCATCTTTCAGCACCGCCTGATTTAGGAGGACCTAACCCTTAAACCTTTTGATCTCGAAAACCTTTTATTCCAGCCCTCC CTCTATATCCCGGTGGGCGG atgttcgaattcaagaggtacgttaatctcggcgaggatctgttcgtcgtcagaaattt aatcggagccatcctggagggtgttggaatagcctatctgattcccgttctccttatgtggttctatccgtccgaggtta gatacgtttactactttgccataccagggtttatgagcattctccttggggcttggctctcgaggcatcaggagagaatc gaggatgttaacctgagacaggccatgatctcagccgcctttatctggctcttcgcgtcctttgttagcgttgttccctt catggagattgcggggatgagcttcatagattcgtattttgagagcatgagcgcctggacgggaacgggcttaactatga tgagtaatctcgagagctatccaagggttctcctcttctggcgtgcttggatgcagtggctcggtggcataggcatagtc ctcgttgccctgacggtcttgatacgtcccggggtcgccgcggccaggctgtacaaggcggaggcgaggagtgagagaat ccttccaaacctcgcgaacacggctaaggtcatattccagatatactttgccctaaccctcgtcggtgcgtacctctacc acatcaacggcatgaatctcttcgacgcgataacgcactccatgaccggcctcggtaccggtggaatgagcggtcacgac gcgagcattggttactttcacagcatgagcatagaggccatcacgattttcctcatgatccttggtgccgttaacttcac ggttcactacaaggttttcaaggaaaagcggcttggacccttcttcgacgacattcaggttcgatacatgttcctctttt tgatacctgcgatatccattatagcctacggtcttgtacggtacggtgatggtatcgcggactctctcagacaggcaatc ttccacgccgtttcggcgataacctgcacgggttttggaatatcagacctgtcaaagtatccagagctttccaagttcat tatcgcccttctgatggtcattggtggcggggccgggagcaccgccggtggaatcaagctcatccgatttaccctcatgt acgagagcctgaagtggacggttcagcagtccattcttcccaaaggtgccgttatcaggaggaaggtggggagctacgtc tttaccgttgaggatcttcaagaggttaccagcttcacgatgacttaccttgctttcctcctcctggggacactttacgt tatgatccgggtgaaggcttcgctcgtggacgcgttcttcgaggtcgcctccgcccagggaaacgttggtctgagcgttg gcataacctcccccttcctcccccctgacgttaagacggttctcatattcctaatgtggactgggagactggagatcttc tcaatccttgtgttcctcgttagcgttgccgccatctttaggaggagg TGAGGCCTTTAGAATATCAACGAGGCTCACT CCCTTCCCCGTCAGTTCGGCCTTGAGGTCGTTCAGCTTTATCAGAAGTTCAAGCCTTGCGTGCCTGTTCTCTATCTTCTC CGCGTTTTCTATTGCTTCCTCAAGGAAGGCGAGGGCTTTGAGTCTGTTTCGGGGAGCCTCATAGAGGGCCAGACGGTACA GTGCAATCGCCTTATGGAAGGGATCCTCTATAGCGTTGAGGGCTTTTCTGGCCTTTTCATGGTCGCCAGATAGGTAAAAG AACTCCACGAGTTGGCTGAGAAGGAAGTCCAGTCTCTTCCTGTCCTTAACTAAGGAGAAGGCGTAGGCTCCCTTCTCCAG AAGGCCGTTCCGTATGAGCTCTCTGAGTATCTCGACAAGCACGTCTTCACCTGAAGCGTATGCAAGGTTTATGGCAGTTT TCAGAGCTAGATCGCCGTTGAAGTCGTCCCCAGCCCGGTAAAAAGCCATAGCGATGTCCGCCATAAGG