

>tg0864 recJ-like single-stranded exonuclease recJ-like protein (recJ)

>tg0864 recJ-like single-stranded exonuclease recJ-like protein (recJ)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 807449 - 809876 (Additional range around tg0864 is :500nt.)

>Thermococcus gammatolerans EJ3 CCGGGAGGTGGTTGTATGGCAAGAATGCACGCGAGAAAGAGAGGTAAGTCAGGCTCGAAGAAGCCCCCAAGGAGCGCTCC CCCGGCGTGGGTCGAGTACACGGCGGAGGAGGTTGAGGCTCTGGTTGTAAAGCTCAGGAAGGAAGGTTACAGCGCGGCCA TGATAGGGACGATTCTCCGTGACCAGTATGGAATACCCAGCGTCAAGCTGATAACAGGGAAGAAGATCACCAAGATCCTT GAGGAGAACGGCCTCGCACCTGAGATACCGGAGGATCTGATGGCCCTCATCAGAAAGGCAGTCAACCTCAGGAAGCACCT CGAACAGCACCCGAAGGACAAGCACTCCAGGAGGGGTCTCCAGCTCACCGAGAGCAAGATCAGGAGACTCGTTAAGTACT ACAGGAGAACTGGAAAGTTGCCCGCCAAGTGGCGCTACGATCCGGAGCAGGCCAAGCTGCTCGTCCGCTGATCCCTTTCC TTCTTCTTGGTGATGCCCA gtggataagaacgccttcttggagcgggcgagagaaggggccgaactcatcaagatgcac atcgagttaggacacaccataaggcttgtctcccaccgcgacgccgacggcataacagccggagctatcctggccaaggc gatagcaagggaaggtggcagctttcagctcagcatcgtgaaacaggtaagtgaggaactcctcaaagagctcgccgagg agaggagagatgtctacgtattcagcgacctcgggagcggctcaatcgaactgatagataagtaccttgattttgcaacg gttgtcgttatcgaccaccacccgcccgagagggagaagttctcagttgattcacaccttctcgtcaaccccgtaccgtt cggcgccaacagcgtccgcgacctgagcggttcaggagccgcatacttcgtggccagggagatgaaccgggccaacaggg agctggcctacatagccattgtcggtgccgtcggggacatgcaggagatagacggaacctttcacgggatgaacctcgat ataattgaggacggcaaagagctcggcatactcgaggtcaggaaggagctccgtctcttcggaagggagagcaggcccct gagacagatgctagcatacgccaccaacccagagatacctgaaatcaccggggacgagagaaaggccatagaatggctcc gggcgaggggctttgaccccgacaaacactactggcagctccgcgaggaggagaagaagagacttcacgatgcactcgtt ctccacatgataaagcacgccgtcccgaaggagatgatagaccggctgataggcgacgtcgtaatcagcccactctaccc tgaaggggatgtgaggcacgaggcgagggagttcgcaacgctcctcaatgctacgggtcggttgaacgctggaacgcttg gagttgccatatgcctcggcgacgaggaggcctacagaaaggcccggaagatgctcgacgattacaagagggaacagatt gaggctaggaagttcataatccagaactggagcatggctgaggaaggagagcacgcctacgttttctatgccggcaagag catacgggacactctggtgggcatagcggccaacatagctataaacgccggtctggctgatcccgagaagcctgtggtgg tcatagcggacagcgaggaggatgagaacctcgtcaagggatctgccagaacgacagagaaggctctggccaagggctat catctcggggaggccctcagggaagttgccgagaagctcggtggtgagggcggcggtcacgcgatagcggctgggatacg cttccccaaggaaaggatagacgagttcataaagctgttcaacgaggctctggcaaagcaagtggccggaggaaaggaca gtgaagat TGAGGCTCAGGCTGAGATCACCTGGAGGTACGGGGATGAGAAAACTGCGAAGGCCGTTGCCGAGGCTGTTC AGGTTGATAACGAGTCCATGCCAGCTAAACTAAAGAAAAGTTTAAATGTGGAAACCCGATGGGTTGATGGGATCGTAAGG ACAAAGATTAAATACTCGGGGGATATTGAGACCCTCATCAAGGCTCTCGATGACCTTGTGTTTTCGGTCAAGATCGCCGA GGAAATCGCCGAAAAGGTGTGAAGTGGAGGTGTTAAGATGGCAAGAGCTAATCCGAGAAGAAGGGCCACCGCGGCCAAGG ATAAGTGGAAGATGAAAGAGTGGTTCGTCGTTTACGCTCCCGACTTCTTCGGGAGCAAGGAGATCGGCCTCACACCAGCT GACGAACCCGAAAAGGTCATAGGAAGGGTTGTTGAGACCACCCTGAAGGATCTCACCGGAGACTTCACCAAGGGCCACGT CAAGCTCTACTTCCAGGTCTACGACGTCA