

>tg0872 ABC-type dipeptide/oligopeptide transport system, ATPase component (dppF/oppF)

>tg0872 ABC-type dipeptide/oligopeptide transport system, ATPase component (dppF/oppF)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 814506 - 816486 (Additional range around tg0872 is :500nt.)

>Thermococcus gammatolerans EJ3 CTCAGTGGAGGTATGAAACAGCGCGTTGTTATTGGAATCGGGGTTTCAAACGATCCAAAGATCCTGATAGCGGATGAACC CACGACTGCCCTTGACGTTACCGTCCAGGCCCAAATCCTCGACCTCATGAACAAGCTCAAAAAGGAGTACAACACGACCG TGATTTTAATCACCCACAACATGGGAGTCGTCGCAGAGATGGCAGATCGCGTTGCAGTCATGTACGCCGGCAAGATCGTG GAAATAGGCTCAGTGGATCAGATCTTCAAGAATCCCCTCCACCCGTATACAAAGGGCCTGCTGAGGGCTGTTCCAAACCC GCTGGCGAAGATAGAGAGGCTTGAGGCCATACCGGGAACAGTGCCAAACCTGATAACACCGCCCAAGGGCTGCCGCTTCC ACCCGAGATGTCCCTACGCGACCGAGATCTGCAGGAAAGAAGTTCCAAAACTGAAGGAGATCGAACCGGGCCACTTCGTG GCCTGCCACCTGTACTGAG gtgatggcgatggaacccctgctcaaggttgaaaaccttaagaagtacttccccgtcagg gggctcttccggaccataggatacgtcaaggccgtcgatggagtaagttttgagataaacagaggtgaaacctttgggct cgtcggcgagagcggatgtggaaagaccacaacgggaagaacaatcctgaggctcatagaaccaacgtcgggaaggataa tctttgacggaaaggacgttaccaagctgagcggtgaggaaatgaaggccttcaggaggagggcccagataatgtttcag gatccgtactcctccctgaaccccaggcagactgtttttgaaatcataatggaacccgttcgcttccacgggatacctgt tgacgatccggaggagttcgttatagacctgctcgagagcgtcggtctcaacgagatgcacctttaccgctatccccacg aattctccggaggacagaggcagagaatagccctcgcgaggctcttggccctcaagccagagttcattgtactcgacgag cccacctctgccctagacgtctcggttcaggcgaacatactcaacatgctcaaagatctccagaagaagtacgggttcac atacctattcataagtcacgacctcggtgtcgtcaagtacatgagccaccgaatgggcgtgatgtacctcggaaagctcg ttgaagtcggtccagcggagaagatctttgagaacccactgcatccctacacccagatgctcctgtcggcgattcccgtt cccgatccggaactggcgcaggaactcaagaggaagcggatgaagatagagggagaacctccgagcccaataaacccgcc gaagggctgccgcttccacccgagatgtcccagggttatggacaggtgcaagaaagaggagcctcctctggtggaggttg agaaggatcactacgtcgcctgctggctttacgccaaatca TAACCCCCCTTCTTTTTTCAACACTTCATGGAGGGCCC TTCTAAAACCCGCGTCGTCTTCGTAAAGCTGTGAATAAACTGGATCCACGGGTCTACCTTTCACTATCTCCAGCCTGAAA ACGGACCATCCGAGGGGCTCAACGAAAAGGTCATCCAGATCGGCAGGGCCCTTTATCCCGAGGACGTGTTCCACTATTGA GAGGGCCAACAGGGCCCGCCTCACCCTCCCGGCAAGTTCCTCGTCCCGCTTCAGGTTCTTAATATAGCCGGAAGGAATAC CCAGAAAGCGAAGTATATTCCAGCGTCTCATGTGTCGGCCCCTTTCATCAAAACTTCTGCCGGTGAGTTCGTACAGCTCA AGGGCCAACTCCCTGAGGACTTTCCCCACGTTGCTTGGGGTCACGTAGGAGTCCCCGTAGGCTCGGGGAACAGGTTTCGG TGGCATCTTCCTCAGCAGGGCGGCCCTGTGCTCAACCCTCTCAAGGGCAGGGTAGAAGTAGC