

>tg0874 Oligopeptide/dipeptide ABC transporter, permease protein (oppC/dppC)

>tg0874 Oligopeptide/dipeptide ABC transporter, permease protein (oppC/dppC)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 816464 - 818621 (Additional range around tg0874 is :500nt.)

>Thermococcus gammatolerans EJ3 CCCCTCCAGCCCATGAAATAACCCACATCCCCATGATAGACGCGCTCCTCACTGGAGATTTCAAGATCTTCAGCCAGCAC CTTAACAGGCTCTGGCTTCCAGGCCTTACTCTTGGTTTTACGGGCTCGGGCGTTCTTGCCAGGTTCGTCAGAAACTCGTT CCTTGAGGCACTCAGCAGTGACTACGTGGCCTTCCTCAAGGCAAAGGGAGTTCCAAAGCTCAGGATATACCGTCACGCCC TGAAAAACGCCCTCGTGCCCATACTTACAGTTCTCGGCCTCCAGTTCGGTGGGCTGCTCGGCGGAACCCCAATAACCGAG ACAGTATTTGGCCTACCAGGGATGGGCTCATACGTTCTCGACGCCATAAGGAACCTTGACTTTCCAGCGGTAGTGGCCAT AACCTTCATCTTCGCCCTGATCTTCGTGACTACCAACCTGATAGTGGACATACTGTACGCGGTCGTTGACCCGAGGGTGA GGTACTGAGGTGGTGATAA atgtcacaggaagagtacaagaaggggattcttgacaggtttgctgataatctcgtcgag gggataggctcattcatatccctctttaagaaggattggaagaggaaaaaccgctcgaagatggaagagtggaagctgat gctctacgccctcaaccgctcaccccccggattaataggcctagtcctgataggcatgttcatcttcctcggcatcttcg gtccaactctcgcaccttggagctaccgctacttccccgccctcgagaacatgtcgacttaccttgcacccccgggatcc cacgcttacttaccgttttccaacaagacgatatcctaccccctcggagccgacaattatggaagggatctgctgagcct gatcctctacggggcaagaacgtccttcgtgatatccatcatagtcattgtccttggagtgccccttggcataatcctcg gcctcatagcaggctattacggagggaagatcgacgagctcataatgcgcataaccgacatgtttctggccttcccggcg ttgatcctcgctatagcgttctcggccgtcctgcccgagagacttcaatccttcatcagcagtcacaaggtctttgagag cctgttcctaaagatattcgcgttgaaaccgcaggaagcaggaaacctcggaaagctgctggcggttatactggcaatgg tcatagtctggtggccggcatatgcgaggataaccagaggttcaacgctgacggagagggagaagctctacgttgaggcg gcaagggcaataggtctgagctccagaacgataatgttcaaacatatcctgccgaacatcatcgggccgattctagttta cataacccttgacttcggtggagttatcctcatggaggccggcctgagcttcctcggcctcggtgcaacacctccaatag ctgactggggtaggatagtctacgacggctcccagtacttccccgaaaaatggtggcttgttacgttctcgggatttatg atcctgctcgttgccctcggatggaacctcctcggtgacacgctcagagacatcctcgatccaaagatgaggcggagcat agagttcaaggtgaagaagcagaagcagatggaagagaaggagggtggggagaatgcc TGAACCCGTTCTCGAAGTTCG CGATCTCACGGTCCACTTCTACACCTACGCCGGTATAGTCAAGGCAATAGAGGGAGTCTCATTTGATGTTTACAGGGGTG AAACCTTTGCCCTAGTCGGTGAAACAGGCTGTGGAAAGAGCGTGACATCAAGGGCATTGACCCAGCTCATAGAAAGTCCA GGAAGGATCGTGAGGGGGAAAGTTATCTATCACAGGGAAGACGGCTCGACAGTTGACCTGCTCAAGCTCAGTGAGGAAGA GATCAGGGAGATAAGGGGTAAGGAAATAGCGTATATCTTTCAGGATCCACATGCATCACTGGATCCCCTCTACACCGTCG GCTATCAAATAGCGGAGGCAATGGTTGTCCACAGGACCGTGAAGGACTGGAAAGAAGGATTCAGAAGGGCAGTGGACATA CTGAGGCGCGTTCTCATCCCCGATCCAGAGAACAGAGTCAAAAACTATCCGCACGAGCTCAGTGGAGGTATGAAACAGC