

>tg0876 ABC-type periplasmic dipeptide transport protein

>tg0876 ABC-type periplasmic dipeptide transport protein

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 818704 - 821848 (Additional range around tg0876 is :500nt.)

>Thermococcus gammatolerans EJ3 AAGCGGAAGAAGCGCTGAATCACTCCTCTTCCATTTCCACTACTATTGCGGTTGTCGTGTCTATAACACCGTCGATGTTG TGTATGTCGTGGAGTATCTTTCTGGTTAGCTCTCCAAGGTCGTTTGCCTCAATGTAAACGATCGCGTCATAGGGGCCTGT GACTGCATCCGCCTTGATGACGCCGGGTATCTGCTTCAGGGCCTCTATAACGCTTTCAACTTTTCCGATCTCAATAGTCA ACAAAACATAGGCCTTGACCATATCAAATCACCTGTGGAGTTTTTACGGTATTCTCTTGTCTCGGGGGTAATTTAAGCTT TTCGCAATTTGCTCCCGGAGTGCGAAGGCAGAGAACTCAACGGAGCACAGCTTTTACCAATGATTCACTATACATCTCCG TGTCAAAGTGCTGGCTCTTATATCCATATGTGCGCATCGAAAGATTTATTATAGTCATGAGGCACACTTATAGTGCAGAT ACCCCTGAGGTGATACCCA atgagaaccaaaagccaggtactggctgttttggtagtgtttttggtggctttttcagtc gtggccagcggctgtatcggtggtggcggaggcggcacgagctcaagcccaacgcagagctcgagtccaagccagactca aacgtccagcacaactaccacaagcacacaagcgaaattgacaccccagatactcgagatggataaggtctacgttatag agactgacaagagtgttataatcgtcggtccgaagggtgagaacccaaccgcccagatcccaagcggcgtgaagaccata aaaatccagtacgaggtagataccgagaatactcccgatgttaagaccctgatggagcagggtcagggattcggtgccat tgaccccgccttcttccgtgatgaacacgttgatgccctcgttatagccgcgaggcgcgagaccaaccccgagatcagaa ccgagatattcaaggccctctacatgctcggaaacaagctcgtgccagaggtaatcctcggtcagaacaagcagctccgc gtctactgggaatgggtgaagggccgctactaccacccgaccctcgcggagcgctacgacctcctcagcgaggattcgaa cgctccgtccgtcgagatcggtatcaaggactacaagaatggccccgatacctacgttatagccaccatcggctggccgg agagctttgacccggccatgacgtacgagacctttggatgggaactctggcacgagataggtgacacgctcgttacttac tggaaggagaacaccgagaccgtaagccctgacctggcagttgcctgggcccacaacgaagacggcacagagtggtactt ccttatccgtggcggcgttaaggcctatgacccctggaacgacaagacctacccgatagacgcaaccgacgttgccttca cgttcctccgcgtcgagaggcttggacacagcgtcagctggatggtggacagcttcatggacgtcaacaactcccaggcc atgactgaggaagaattcaacaactacctcaaggatcacccgctcgttgccgagtacaacggtcaggttaaggaggttca ctcacttgacgaactcaagcagttcttcggctacaacggcgagactgcaggtgtcttcaagctcgtccttccgaacccgt acgctccggttctaagcatactggccgacccgttcctcagcgtcgtcccgatggagtacctcctcggcgacaagtaccaa gaggccctgcaggccagcaacaacggccatgacccgagcgcctggtggaactacctccagtctggtaaggatgacccaac ccaccagcttatgcaccagaagcccgttggaaccggaccgttctacgtcaaggactaccaggagaacagctacatagtcc tcgagtacaacccgcactactggaacgccaccagcaacccaggccacaagtacgttatctacgtcatcaacaacgacgct caggcaaggatcaacctgttcaagactggcaccgccgatgtcgttgccataccccctgaaaagatggagagcgtgaaggg gcttgagctcaacggcttccactcagttgtcaagaccgacatcctccagccaatactgaccttcctcgtcttcaacaccc agaaggagcccttcaatgacccgaaggtcaggcaggccctcgcctatgcagttccgtacgatcagataaggcagctcgtc taccaaggactcctcgagcccaactacggcccgatacccaagccgtggccgggttacatggaggagggcatcattaagta cacttacaacgtcaacaaggccaagcagctcctccaggaggctggtgttgacccgagcaagtacaagatcgagctcatct acaacgagggcaacagtgcccgtgagaagataatgaccctcctccagaacgtctggagccagctcggattccaggtcacg gtaaacagctacaactggccgacctacctcagcaagacagagcacggcgactacgacgtctacatcgttggatgggttcc ggactaccttgactcggacaactgggttggaccattcctctatggtgccacagagttcaagagcctcgaaatcaacgttt ccgga TGATATCTTTCTTTTCTTTCCCCTCTTATCGAGTATCGAGAACAACAAACTCCAGAGAGGTGAGCAAAGTTGGC GAACCTTAGGAAGTTCCTTGTGAGGAGGCTTCTTACGTTCATTCCAACGATCATCGGAGTTACTCTCATTGTGTTTATAA TCGCCTACGTCATTCCAGCCGATCCGGCAAGGGCATGGGCGGGTGGAGAAAAGGCCACCCCCGAGGCCATTCAGAAGATA AAGGAACAGTACCATATGAACGACCCGTGGTACGAGCAGTACTGGTTTCTAATCAGCGGACTTGCCAAGAACAAGATCGT TGACCCAAGAACGTCAAACTACGTGTTTGATGATATTGGAAAGAGGTTTCCGGTGACGTTTGAGCTAACGTTGGTGGCGT TCTTCTTCATACTGATAATAGGTCTTCCCCTTGGTATACTGGCTGCCCTCAAGAGGAACACGTGGGTTGATACCCTCGTC AGGATTTTTGCCCTGACCGGAGTTTC