

>tg0897 Prokaryotic ATPase, AAA superfamily

>tg0897 Prokaryotic ATPase, AAA superfamily

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 833392 - 835486 (Additional range around tg0897 is :500nt.)

>Thermococcus gammatolerans EJ3 ATCGCTACCACCGCTCACCCTTTGAAGAAAGTGTTATAAACCTTTTCACAAAGTTGTAGACAGGTATGAAGAAAAATCTT CAGGGGATTGGAATGGAGGAGATACTCCGAGCCCTGTCCAAAACCCTCAGGGTCTTTGAGCTCGGGGAGTCCGAGATAAA AATCTACTCCCTCCTCCAGCGGGAGGCGCTTACGCCGAGGCAGATTGCAAAGACGCTCGGCCTATCTGAAAGGATTGTAA GGGAAAAGCTTAAGCACCTCCTCGAGCTGGGCCTCGTCGAGAGAACCCTCGTGAACAGGGGCTGGCTGGGCTACGTTTAC TACGCCAAGGCCCCCAGGGAGGCTCTCCAAGCGCTCTTCAGCAGGCTGGAGTCCACGCTAAAGGCCATAGAGAAGGAAGG TGAGCTGAAGCTGAAGGGTTAAACCTCATGCAACTTCCTTCTCCAAGCTTTGGAACGTCAAAACCCTTATAACTTCTGCC CCAGTAGTTAACTACTGGG gtggtagttacgtacttcgataccagacccaagagaaagcgtgaggatttgtatgaccgt gagaaggagctgagcgattttgaaaactccctccgctcgaacaaccccctcacggtcatcacgggaatcagaaggttggg gaagacttccctcctcctcgtggggctgaacgaactcggccttccctacgtcctcgtggacttcaggggggtgaatccaa actccagaatggacgtttacaagcggatagagagctccctaaaccttttcttccgcgagaaccgcaacctctgggaggaa ctcaaggaaaacctaagggccataacgggccttcgagttctgagcttcggcgtcaacctctcctggcgcgaggagaagac ggactttatagccctgttccgggatctcgaaaagcacgacgtcgttctggccttcgacgaggtgcagtatttgaggggcc ccgtcgggagcgagttcgcgggcctaatcgctcacctctacgactactcgaacctgagaatagtcatgacgggctctgaa gttggcctgctccacgactacctcggcgttgacgacccccgggcgcccctctacggcaggtacttccacgaggttacact cccaaagttcacgcgggagcagagcagggactttctgattaaggggttcgagcaggttggactttcccctccagaagagc taatcgagaccgcggtggagaggctcgacggcatcgtaggctggctcgttctctttggcaggagggttcttgagaagggc ccctctgaagaagtcattgaggaggtctttgaagaggccaggagactcgcgctggaggagttcgagaacttcctctcaaa gaggccctctgcgaggaaacgctacgtggagataatgcgcgcagttgcgagcggaaggaacacgtgggaagggataaagg agcacctcgaacggaaggaaggcaaaagcatagccgacagcgtgctggcgagacttttgaaggcgctcgtagattcctcc ttcctccagaaggtcagggacggtcggaacgtccattatagaattcccgacccggtgcttgaggcggtgttcaag TAAC AAGAAAAACAGGGAGAGAAGAAACGCTCACGCGTTCTCCTTTCCTTCCCTCTTCTTCGTGAGGTATTCGTGGATGGCCTT CGCGGCCCTCCTTCCGTCGCCCATAGCCAGGATAACCGTTGCCTCGCCCCTTATCGCGTCTCCACCGGCGAAGACTCCCG GGATGCTCGTCATCATGTTCTCATCAACGACGATCCTTCCGCGCTCGACCTTCAGACCGGGCGTGTTGATGATGAGCCTG TTGGGGTGCTTGCCGATTGCGATGATGACGGTGTCGGCCTCGATTGTCACGTACTCTCCAGTCCCGACTATCTTCCTCTT TCCGCGCTTGTCCCTCTCGTCGAGGGGTTTCATCTTCTCGAACTTGACCGCTTTCACGTTGCCGTTCTCGTCGCCGATGA ACTCCACAGGGTTGATGAAGTACTCGAACTTTATGCCCTCCTCCTTGGCGTGCTCGACCTCCTCAATCCTCGCGCTGACG TCCTCTTCACCGCGCC