

>tg0917 L-asparaginase/archaeal Glu-tRNAGln amidotransferase subunit D (gatD)

>tg0917 L-asparaginase/archaeal Glu-tRNAGln amidotransferase subunit D (gatD)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 848433 - 850749 (Additional range around tg0917 is :500nt.)

>Thermococcus gammatolerans EJ3 CCGGAGGAGCAGATGAAGGAAGTGTCTCCTCAGTTCCCCTATGAAGTCGCCGAGACCGAGGAGGTAATCGGCCTCGGGGA CTCCAAGATCCCAGGGAGAGGGCAGCTCCTCCTCCGTCAGATACGCCAGTAAAAGATTGGCCTCGACGAACTCCTGGTGG GCGCTCTGGACGTAGCCAGAGTAGTAGAGCATTGGGTAGGGAGATAAGAGATCTTTAAGCTCGTCAACGAGATTTCCCGC CAGTTTAAGCCTTTTCCGGGCTTTCTCAATCTCTCCTCTGTGGAGGGCCTTGACGGCGTCGCCGCTCAGCCTTACGATTT CTCGCGTCATCCTTAGGGCCTCCTCCCTGGCCCCATCCACTTCATCGAGCCTTTTCCTTATGCCTTCTATTATCTCCTCG ATCTTCATGTTCCCACCGACTCATTTTGGAAAAAGAACTTATAAGGGCCCCGGCATTGTTTTATAGTGGTTGTGTGAGAG CAAGTGCCGGGGGAAGGAAG atgagaaaggttgaggagttcatgaaaaggcataaccttgaagtgggcgatctcgtgag gcttgtcaagagggaaggggacgagaaaattacctttgagggcctcgtgatgccaccctacgagctttcgcccggcgaaa cgctgacgataaagctcgacaacggctacaacgtcggcgttctcattgatgcaatcgaaagcgttgaaatccttgagaag gccgctgagaagccgaagatggagttcaaggaggtccttccgaggaagaagggcctcccaaacgtcaggattcttggaac cggaggaacgatagcgagcaggattgactacaagacaggtgccgttcatcctgccttcacagccgaagagctcgcgaagg ccgtcccagagatattcgagatggccaacgttacgccaaagctcataatgaacatcctcagtgaggacatgaagcctgcc tactgggcgaagatagcggaggaagttgcaaaagcccttaacagtggagaagacggcgttgtaatagcgcacgggacgga cacgatggcctacacttccgctgctttaagcttcatgctgaggaacctcacgaagccggttgtcctcgttggggcccaga ggagctccgacaggccgagtagcgacgcggccatgaacctcacctgtgccgttaagatggcgacgagcgacgtcgccgag gtcatggtggtgatgcatggcgagacgagcgacacctactgtttagctcataggggaaccaaggtcaggaagatgcacac cagcaggagagacgccttcaggagcatcaacgacgtcccgatagcaaagatatggccgaaagggggaatagagttcctca ggaacgactacaggagaaagagcgagggagaagttatagcggacacgaagatggaggagaaagttgcaatcatgaaaatc taccccggaatcagtggtgagctcctcgacttcctcgttgataagggctacaggggcgttgtcatagagggaaccggtct cggccacgttccgcaggatttcatcccccacgtccagcgcgcggtcgaggagggcgttgccgtctgtgtgaccagccagt gcctctacggcagggtcaacctcaacgtctactccaacggcagaaagctcctgaaggctggagccataccctgtgaggac atgcttccagagacggcctacgtcaagctcatgtgggtcctcggccacaccgatgacctaggcgaggtaaggaagataat gctgacgaactacgccggcgaaatcacgccctacacgaggtacgacacgttcctgagg TGATGAGTGTGGGCATTAAAG CAGTTTATAAAAATGGGGTCTTCAGGCCTTTAGAAAGCGTCAAACTACCCGAGGGAACAGAGGTTGAGGTCATAGTGAAG AGCGCCGGTCCAATCCTGAGGAAATACGCGGGCATGTTGAAGAAGAGCGAGCATGATTGGGAGGCAGAGTACTATGAGTA CATCGAGGAAAGAGCTGGCGGTAGTTGACAGCAACGTGTGGGTTGAAGTCCTCAGTGGAAACCAGAGGGCAGTTGAACTC CTTGACAGAGTCAGCAGAGAGTGCAAGCTGTGTATAACTCCCACCATCTATTCGGAGGTTTCCTTTGTCATTCTTGGCCA TCATTTCACCTCCAAAACAGGAAAAAAAGGAACCTATGCACTCAAGAAAGAACTGAAAAGAGACCCCTCACTTTATGAGA TTGTTGATACCTTCGACAGCCTACTCGATGAGCTCCACATTGCTGGATTGCTCGAGTTCTTGGAAGAAACTGAGGAAG