

>tg0927 Peptidase U62, modulator of DNA gyrase, PmbA/TldD protein-like protein (tldD/pmbA)

>tg0927 Peptidase U62, modulator of DNA gyrase, PmbA/TldD protein-like protein (tldD/pmbA)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 859989 - 862362 (Additional range around tg0927 is :500nt.)

>Thermococcus gammatolerans EJ3 ACTCAATGTAATCGCCCTGCTTCTCCACTTTCATTTTAGTGTCTCCCGTGAGCTTGGATGGGTCTATGTCCTTTCCGGTT ATGACGATCGTCGCGGTCTCCCCAGAAACCTTTTCCTCGCAGGTAAAGTGCTCCTTCTCGTAATCCGTCAGGTTCTCCCT GAAGTCCGCGCAGAAGGAGCCCTCGCTGGTGTTGGAGAGCGCGAGAGAGTACACATCCCTGCTCATGTTGATGGCCATCT TGAGGAGCGCTATTTTCCCGTCGGAACTTACCTTCACGTGCTCCTCAACGGACACACAGCCGGCAGCAACGAGGGAAAGG GCAACGACTAAGATAACCAATGGTACGACTTTTTTCATCATAGCATCCCCAGTGTTCTAGGTTCTTACTTCATTAAAAAC TTTATTCCCCAATGTCCTGACTATGCTTAGATGCTCATCGAAAGGCTCAAAAGGCTTTTATAGTTGCCCCTCTCACAAGA GATTGGACAAAGGTCAACG gtggtggacatggaggcacttgaaagggcccttaagtgggctgaagaaaacctgaaggcc gagtacatcgagctgcgctacgaggacttaaggaagaccacgctcggcctcaaggacggcgtctttacgagtttcacggg gaagctccacaggggcgttgccataagggttctggcggacggtgcctggggctttgcctcgacgagcgagcttgagaacc ttgagaagaagattgaagaggcctacaagctcgccagggcggccgcgcagacgaagaaggagaaaatccagctcgcagag atagacccagtcgaagacttcgtgaagagcaagatgcgcgtcaagccaagggaagtggacattgaggagaaagtttccca tctcagagagcttgagaagctcctcaaggaagacgaggccgtcaagagcgttcagattcgctacgaggacggcggaggga agaagatactcctcaccaacgaggggacgaggatagagtgggactacaactacctctaccaaggaacatacgtcaccggt aaggccgacggaaagctcgcgatggcgagggacagcattggagccgttgactacggctgggagcttatgaccgagataga gccgaacgagaaggtgaaggagaggcttctcaggaagatgcacagccagctgaaaggagtggctccgaagcgcggtgagt ggccgattgtggctggcccgatagtcgttggaatcatcgcccacgaggctttaggccacctcgccgaggcagacctcacg ataaactcgcccttcaaggacctcatcggcaagcagattgcccccgagtacgtcacgatgagcgagcgcatcgttgaagg cggcttcggaaacgacaagtacgacgacgagggggttccggtcaaggacatccacatcatcgagaacggaatcctgaagg agataatgctcaaccgcgagtacgcccacaagtggggaatggagccgaacggccatgccagagctgaaagctaccgctac ccgccgatcatcagaatgaggaacacggtcttcgaggcaggcgaccactccttcgaagagctcatcgaggacatcaaatt cggctattacgtcgttgacttccgcggcggtcaggcccagctcaacagcgccttccaagtcggaatccaggagggttacg tcatcaggaacggcgagatagcggaaccgataagggacacttcgattaccggcgttgcgatagaggccctcaaaaagata agcgccgtcggcaaggacttcggcctcgaggtcggcttctgcggaaagggacagaccgccttcgtgagctcaggtggccc gcacatgaggtttgacgggggaatactgattggc TGAGGTGGTGACGATGGAGAACCTCATACGCTACGCTGAGAAGCT CTTCGATGAGGTTGAGATTGCAGTTTACCGCTCGAGGGAGGTCAGCGCGAGCGTCGAGCTTAACGAGATTTCGATGGCCT CTACGAGGAGCGGGGCCGTAACGATAATCCGCGGTATAAAGGACAAGCGCCTCGGTTTAGCTATAGTGGACAGCGACGAG GAGAAGCGCGTTAAGGAAGCGATAGAGCAGGCCGCGAAGATGGCGAGGCTCAACAGCAGGGACGAGAAGTGGCTCTCACT GCCGGAGCCGGGGAAATACAGGGAGGCGCCGAAGCCCAACTACGAGCTGAAGGAGGCCTCGCCGGACGTTCTCGTCGAGA TGCTCGTCAGGGCTATAAAGCTCGCCCGCGAGAAAGAGCCGAACGCCGTCGTCGCCGGCGGAGAAGGTGGCGTCAGCTGG GAGGAAAGGCACGTCGTCAACTCCCATGGAATAGACGTCTTCCAGGAGGGAGGCG