

>tg0929 Peptidase, prolyl oligopeptidase family

>tg0929 Peptidase, prolyl oligopeptidase family

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 862320 - 865215 (Additional range around tg0929 is :500nt.)

>Thermococcus gammatolerans EJ3 ACACTAAAATGAAAGTGGAGAAGCAGGGCGATTACATTGAGTTCTGGGACTACACCTGGTACGAAGAGGGCAAAAAAGAG GAGAAAAATGAAACCGACTGGGATAAAGAGATCGCAAGCCTTTTCACGATAGACTACTACCTTGAAATGCCGGGAGAGAT CGTTGATTCCAACGCTCAGGTGGTTAACGGGAACAAGGCCGAGTGGCACTGGAACCTTTACGTGGCCTCAAAGCGTCCGA TCTACGCCAAGGCAAAGGTTGAGGAGAAGAAGGGTCTCTGCGGTCCGGCTTTCCTCGTGGGTCTGGCAATAGTGCCGCTT CTCTTACGGAGGCGTTAAGGGGTTCTTTCCTTTAATCTTTGCCTTCAAAATAATGACCTCTTTCATTGAAAGGACGTCTT TTCGTGTTCTTTGACTTTGATTGATTTGCCTCTTTATTTAGATATTAGTCGAAACGCTAAGCTTTTATACGAAAAGAGCC GATTTATCTTGGTGGTTTCT atggccaaagggctgggtattaaagacatcggaaagttcaagctcgttgggaacatcga cgccttcgggagaaggcttgttttccaggtcacggaaataagcgtcgagaaggacgactacttctcaaagctttacctct acgacggcaggaaagttaagcccttcacctccggaaagaaggacggaaacccgcgcttctccccggacggaaagctgata gccttcacctccaagcgcgataaggagagcaaggaggccgagctgtatgttattccgaccgacggcggcgaggcgaggct tttaacgaagttcaagtacgggattaagaacctccgcttcactgaggacgggaagagcgtagcggtcgttacgccggtaa aggttgagaagaagccgaaggacgacgtgcacgtcatcagggagatccccttctggttcaacggtgtgggctgggtctat ggaaagaggagcgttgtccatctggtggacgtggagagcggaaagaagaggcgcgtaacgccgaagagcctcgacgtctc gcaggttcgcttccacaacggcaggctgtacttcgttgcccaggaagaccgcgagaaaaagccgatggtcagcgacctct acatccttgagggcaggaaggcaagaaagctgactccggggaagtggagcgtgagcgacttcattccgctcgacgacggc actttcatcctcaaggctaacacgcgcgagcgcgggattccgacgaacactcacatctaccactacaacccagagacggg cgagctgaggaaactcaccgctggcttggaccgttctgcatacaactccctcaacagcgacgtccgcggaagccagaggg cagaactggttttcaaggatggctgggtttactacgtcgcgaccgacggcccgagggcgaacctcttccgcgtgaacctt gaggggaagatagagcgcgtcgttggtggaaataggagcgtcgagagcttcgcaatcggggactacatagccttcaccgc ccaggacgcggtcactccgacggagctctacgttctcagagacgggaaggagaaaaagctcaccgacttcaacggctgga ttaagggctacaagctctccagaccggagcacttcaaggtcaaggccagcgacggcgccgagattgacgcgtggattatg aagcccgttgattttgagccgggcaggaaatatccagccgttctggagattcacggtgggcctaagacggcttacggtta ctcattcatgcacgagttccacgttttgacggctaaaggcttcgtggtaatattctccaacccgcgcggcagcgacggct acggtgaggagttcgccgacataaggggtcactatggggagagggattaccaggacctcatggaggtcgttgatgaagca ctgaagcgcttcgacttcattgacgaggagagaataggcgtcaccggcggttcctacggcggcttcatgacgaactggat agtcggccacacgaacaggttcaaagcggccgtgacccagcgctcaatctcaaactgggtgagcttcttcggaacgacgg acatcggctacttctttgctccagaccagatagggggcgatccctggagtaacaccgaaggctactgggagaagagcccg ctgaagtacgcgccgaacgtggaaactccgctcctcataatccactcgatggaagactaccgctgctggctcccggaggc gttgcagttctacacggcgctcaaatacctcggcaagaccgttgagctggcgctctttccgggcgagaaccacgacctga gcaggggcggaaagccgaagcatcgcgttaagaggcttgagctgatagcaggatggatggagaggtggctaaagggg TG AGTCTGTCTTTTTCCTTTCATAACCTTTCATAACCCTCAAATATGTGAATCCACGTATTTCTGTGCGGCGATGGCATGCC AAACATAACCCTCTCAGTCCCGCCCGACCTCTACAGGAGAATGAAGAAGCACCCTGAAATAAAGTGGAGCGAAGTGGTAA GGAAAGCCATAGCGGAGTATTTGGCCAAAATCGAGGCAGAAAAGCTTTAGCTCGGATGAACTGTTATCACTCCTTGGCGA GGATGTGATAGTCAAGAAAGGGGCACCCGGGCCGGTGGTTGATGCGGTAATTGTTGCGGTTGCAATGAACCGGGAGCTGA CGCTCTTTACGAGGGGCAAACACTTCGAGTGGATAAAAGAAGAGTTTGAAGGGCTAAAGCTTTTAGAGCGTTAAATTGTT TTACTTTCTCCCCGTATTCTCTCAATGTCTTCGTCGAACTTTTTCTTCGCCCACTCCAGCTTGTCAAAGGCGAGTTTTGA GGTGAGAGTGTAGACAA