

>tg0952 Adenylosuccinate synthetase (purA)

>tg0952 Adenylosuccinate synthetase (purA)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 884052 - 886068 (Additional range around tg0952 is :500nt.)

>Thermococcus gammatolerans EJ3 ATCGCCGTAAACAGCCGCTGATGATGCAAATATGAGCTTTCCGTGTCCTTCGAGAAGGGCCCTGAGGATGTTGAGCGTTC CGAGGACGTTCACCTCCTCTGTAAAGACCGGATCGCGTATGCTCTCGACGACGCTCACCTGTGCCGCCTCGTGGAAGACG TAGTCAGCATGACTTATCAGCTCGGCTATCGCGTCGTAGTCCCTTATGTCGGCCTTGACGAGCTTCGCCCCCGGCGGGAC GTTCTCGGCCCTACCAGTGTAGAGGTTGTCGATCACGATGACCTCGTTGTCCTTGACGAGTTCCCAGGCTATGTGTGAGC CTATGAAGCCGGCCCCGCCAGTGATAACTACCAGCCTGTTTCTCATTCCAATCCCCAACCGTTGGTGTTAATCAAGAGTT TTAATCTTTTTCAGACATTTCCCGTCTTCCATTAACATTGAAATGTCCAATTCGAAACCATTATAAGGGCCCTCTTGACT TAAACGTTGGTAAGGAGCC atgccgagctacatcgtcgttggcggtcaatggggagatgaaggtaagggttctatcata gcctacctcgccctaaaagacgaacccgaggtcatagcgcgtggcggtgttggaacgaacgcgggacacagcgtttttat caacgggaagagatacgcggtgagacagctcccgaccggctttatacagaccaaagcgaggctcctcatcggagcaggcg ttcttgtcgatcctgaggtgttcttccacgagcttgagcacctcaaggacttcaacgtcgccgggagggtggggatagac caccgctgtgcgataatcgaggagaagcataaacagcttgatcgctccaacagccacctccacgacaagatagggacgac gggaagcggttgcggacctgctaatgcggacagggtcatgcgaaaggcaaagctcgcaaaggaggttcccgagctcgaac cttatctaaccgacgtggcccaggaaatcaacgacgcgctcgacgagggaaagctcgtcctcatcgagggaacccagggc ttcgggctgagcctctactacggcacctacccctacgtgacctccaaggacaccacagcctccgccatagcaagcgacgt cggaataggcccgacgagggttgacgacgttatagtcgtcttcaagagctttccaacgagggtcggcgctggacctttcc cgacggagatgagccaggaggaagctgaaaaacttggcctcgtcgagtacgggacggtgactggaaggaggagacgcgtc ggctggttcgactttgatttcgcccgctattcggcgagaatcaatggagcaaccatgatagcgctcacgatgctcgacaa gtacgataagaacgccttcggtgtaaccgactacgataggcttccaaaaaaggccagggagttcgtggaagaaatagaag ggcgcgtaggtgtgcccgtcgggctcataaaaacggggcccgaactggagcacatcatcgacaggagggaggtcatt TA GTTTCACTTTTCCTTAACACCACCTCAAATTTGCCTTCCTCGCCGATGTCCAGTCTGAGGGGAACGTCGAGTGCGAGCCG TATCCCATACCTCCCGTGACCGGCTATGCACTCAAAGCCGTCCTCCCCAAAGGGATCCTCCCTCACGAGCAGGCGGAGGA GTTCCCTTGGGGAGATGGTGCGATGGGCTATGATCAGAACGTCGTCCTCAGGGAGGAGTCTCTTCGAAAAGGAAAAGTTG ATGCCCTCCCCAATCCTGAAAACGTTTGATTCAAGGGCCGAGTGAAAGATCTCGACCTTGGCCTTCCGCGCCTTGAGCAG GTTCCCGTAGACGCTGCCCTCTATCGTTTTACCCCTGCCCTCGAATACAAGCTCAGCCTCATCGTTTTCCCATGTGGCAA CTATCCTGCCCGAACCGGTGACTTCACCTTCGCGCGTCGCCACGAGCATGAGCAAACCCTCACCGGGCCCGGAGACAATC CTCAGAGCCGGAAACTCA