

>tg0963 Sodium:solute symporter family protein

>tg0963 Sodium:solute symporter family protein

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 894500 - 897113 (Additional range around tg0963 is :500nt.)

>Thermococcus gammatolerans EJ3 GTCCCCTCTCTCCGCGCCGAGTCGGTAGAGGTCAACGTAGGCGAAGTAATCGAAGACCTTATCCCTCATTCCCAACCTCT TGTAGTAGAGCCTGAGGTGGTATATCCTGTATGGATACAAAACGAAGCCTGATTCTATCTCAGGACGGAATATAGGGCGC ATGACTTTTACCCGGTTCATGCTCAACACCGTAACGGTTTGTACTAATTCAGCTTCCCAAATTTTCCCAAACTATTCAAC ATATAGTTTTGAACGGTAGGTTTATAACTTTTTGGCAATAATATACAGTGCTGGCCATTGGCCAGCATATATATGCAGGA GGGTTCAATATGGGGCTCAGTGCCGGTGGATGGGCATTGCTACTGGTTCCAACCCTTTTGGGAATAGCAACGATGCTCCT CTATGGTTTTTGGGACAGAATAACCGGCGAGGAGTACTACGTTGACGACGACATTTTAGCATACGACGAAGACCTAATTA AACAGCAGGAGGGAGCGGC atgaacacagggatactgatcggcttcttattctacctcgcgttgctggcctacatcggc tggtgggccaacaagtacaccaagaccgaggaccagtacttcgtgggcggaagaaaggttcatgtcctggccgctacact ctccgataaggcgagcgacttcagtggctggctgatgctcggttatcctggaagcgccttcaaagccggtctcggtgcct tttgggctgcggtgggctgtctctttggaacgctcgcggactacgttctaatcggcccgaggctgagaatctacgccggt aagttcagggcgataacagttccggactaccttgaggcaaggctcaaagacaacaccaagctgataagaattctcagcgc gctgataatcctcatattcatgaccgcctacgttgccgcccagttcacggccggtggaaagacgttcgctgagggttttg ggatcagtgacaacgcgggaataatcctcacagtgataatcctaacggcatacgtcataaccggcggcttcttcgcggtt gtctggaccgacgtcgttcaggcaatgttcatgctcctgactctgataatcgtcccattccttgcgcttgccaaaatagg tggtttcgacaaggctacccagataatagcccaagcagacccgaccaagctcgaccccttcggaggggcaaccggctggg ccgcgataatattcgccatcggctacgcctcttggatagtcggttacctcggccagccacacatagttacgcgctacatg agcgttgaggatccaaggaagctcagaaggcccggaatcttcatcagcggaacctggacaataatcgtcctctggggtgc attcttcgccggattcctcggtttcgcgatgtaccaggctggaatcctcaatgtcagcgacccggagaaggtaatccccg cgatggccgttgagctcatgcccggctggttagctggcttcgtcatagcaggtataatttcggcagtgatgagcaccgcc gactcacagcttctcgtcgcttcctccgccatagcgagggacttctaccacaaggttctcggcaaagaggtcggcaagaa acagatggtcaacatatcgagggttgtcgttgcagttgtcgccctcgttggcctctggttcgcgttgactgggcctaagg tcatctaccagatggtcgcaaccgcttggggcggtctcgcagtcggcttcggcccgattctcgtgctgagcctctggtgg aagcgcgtcaccaaagaaggcgcaatcgtcggcatggcctacggccttgtcagcgaagtcattcttgaggccaaggtcta cggctgggccttcaacccggatgccccaggaattttcggaacaatcggctcatggttcaacggcgttccggtgttcttca tcaacttcttcattaccctgttcatcataatcgtcgtcagcctcttcacgaagccgccggaagacatcgtcaagctccac gaggagctcttcaggaaggttcccatcgagaccggaaagaaaagcatcaccgagaccagggccaagagccaggtcgagaa cgtcgccgacttcctcatcgagcgcggtctcgcc TGATTCCTTTTTTAACCATTTTTGGACAACCTAACGTTTATAAGC ATTGGTGTATAAGGTCGAACGCGACCGGAAAATTTTCGGGGTGGGAGCATGAGACCGCTCGACCTAACTGAAAAGGACCC TTCTAAGAGAGTCACGATTTACTTTGAGGGGCAACCCCTTGAGGCATACGAGGGAGAGAAAGTTACCGTTGCCCTGCTCG CGAACGGCATATACTGGCTCACGACGAGCACGGGGGGAAGAAGGAGAGGTGCCTTCACCTTTGGCCCCGTCCCGATGGTC GTCAACGGCGTCAAGAACGTCAACGCGAGGAAAACCGCTGTAAAGGACGGTATGAGGCTCGAAAGGCAAGGCTACGACGA TTTCCAGGAGAACGTGGAAATTGATGAAGGTAAGCCCGTTCTTCAGTACGTGGTTGACGTGGCCGTTATCGGCGCCGGTC CGGCTGGTCTCGGCGTCGTCAAGGAAATCGGCGGAAGGCTTACGACAGCGATAAT