

>tg0968 Serine/threonine protein kinase

>tg0968 Serine/threonine protein kinase

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 898639 - 902467 (Additional range around tg0968 is :500nt.)

>Thermococcus gammatolerans EJ3 TATGCAGTTGCCGTTGCAGATAACGGGGACGTAATAGTGGCAGGCTACACTGATAGCTTCGGCGCTGGTGGCAAAGACGT TTGGGTTCTCAAGCTTCCGTCCAGTGGCGGAGTACCGGGGTGTGAAGTTTGTAAAGCGTCTAACGTTGAGACAGCGTTCC TCGGGATTACAATAGGCACAAGTGAAGCAACAATTTCACAACCATCGATTAAGGTAACGGAAAACATCTATGTTTACCCA ACTCCATGGAATCCTCATATAGAAACACAATGCGCAGGACTCAGAGCGACCTTGAATGTTTATTCCACTCCTCCTGAATC AAATGTCTATATCAACGGGACTTACAAAGGAAAAACCCCACTAACTTTGAATTTAGATCCCGGTAGATACCTTGTGAAAA TAGTTAAAGATGGATATCGGGAATATTTGGTCAACGTGACCCTAAGCAGGGGAGACGTGAAAAATATCTCGGTGACATTA CAACAATTAAAAATAGAGA atgtctggctccatgttgggggaaaaacgtctaatagttaagaacaattcaggtctgtac ttaataacgcttctgaatgttgacatggatatggataaagttacagcactggtagaagtttacaatatcgcagaaaagac taacgaacatatcttacttcatgaaggagagcgcgcctacaacagtactcttaaaggatttgacatgagattagattcag tatttgtgggcattgacgacagtacaattgcaaggattacattctatcttgtcgacgatatgaacttaacaactcttggc acattgacttttaagtccactccatcaggagcaagtgtgtatttaaacggagattacaaagggacaacacccttaacatt gtcccttctccccggaaattattcggtaaggttttcaaaaaatggctattatgactatacaacaaaggtagccatctccg cgggtgagaagaagacgataacagcagtactcacgccagaattcggatatctaaaaattacaacagaacctccaggggcg aatgtatacattaatgatgaatacattggtagaacaccaattagccattataaactctcaaccggagcccatacggtaat cctcaggatgaaaaattatgaaagttacgtgacaaatgtaacaatacatcccggtgaagagacaaacttagcaattacat taacgcctcttccatcacacttgataataaactcagttccgtctggatcagaagtctatgtcaatggaacgtatagaggt aaaaccccactccatctgactattaagcctggaacctacaatctaagggtatcgaaggaagatcacggtgagtacaccac gactttcatgctccaaccaaatgaaactaaaactcttaacattactctgactccaaactacgcgcatttgactattaagt ctgatccaccgggagcaagcatttatataaacgaaacatacaaagggaagaccccattgactgttgatctaatgatggga acttactcaataaaactctccaaggagggttatcaggattacacgctcaaggtaaccctctcgcccggggagagtaagac actttctccgagtctgacaccagcttatggattcttgagcgttacctcagaacccgctggggctgatgtttacattgatg gtaattacgtcggaacaacccctctaacgaattacaagctttctccgggcgagcatgaagtgaagatcaaaaaggatggt tacaaggagtacacgaaaaccgtgaccatcacagcgggagaaaagaaaacgttgagtacttccctcgtactcctactccc accaacctcaagcaccacaacagcctcaggaatcacaaccacatcaaccactacaacaactactaccacaactcctcccg ccttcacttcagaaactcctgctccagctcaaacctcaggcggttcaaactttaacccaatctacatcgcaggagcacta atcggactcctcttggtaggtggtgttatggcgaaagctagaggcggaaaatccagagagaagccgaagccagagccggc accgatagaggataaaagacctgaagaactggcggtgccagcgaggaagcacgcccaccaagaaatcccagtcccgggct tcccgcccgagctcttggataaatacgagcccctcgaattcctaggcgaaggtggcttcgccaaagtattcaaggccagg agaaagaaagacggaaagatcgtcgccctgaaaatcccgcgcattgatgagaggacgagcaaaacattcctcaaagaaat cacggcatggttgcaactcgaccatccgaacatcgttcgcttgtatgacgttgacatcctgccagttccctaccttgaga tggagttcgttgagggtgttaacgtcgatggaaaaacggtcagggatctgggaggatatccgaagcccgttgacgagaag actgctttgaaactcatcaaaggcatcgctgagggcctcaaacacgcacattcaaaaggcatctaccaccgcgatttgaa accgctcaacatcctcttgaagagtgacttaacgccaaagattaccgactggggactggcgaagctcgggacgatgagct ctggcaggagcgtccttggatacacccctctctacgcttcccccgaacacctgatgccgggcaagtacgggcataccgat tggagaaccgacatctggcagttaggcgttaccttctacgagctgttaaccggcaaactaccttttgaaggctacactta cgaagaagtcttcggcaaaataacagatgagagctaccgcttcacgccaccctcaaagattaatccagcgcttgccaagt acgacggcatcttcgagaagctcctcgcgaagaggaaggaggagcggtaccagagtgttgaggagtttcttaaagacttg gagaagcttgatgaagtggaaaaaaagagggccgagctggaaaaggaagtcgaagagctcaagaagaccctctcaaagag cgttcaggctctcaagaggagcaccacagttgaggagaccctgaggaacagaaggctcgtggttgagacgctcggcaggc tggctctggcttatgccgagctcaacaggaaggcggagcttttgaacaccctcaacgacctcaagttctacacggttcag aaccttgtcgatctcaccaatgcgataaacacggtggagcttctcatcaaggagaaccttccggtgagtgacgacttcat agaaagacttaaggtgttgattcacaacataaagagggaaaacggggcg TGATAGCGTGGTTCGGTTCTGGAAGTCCAA GGAGGAGAGGGATATCGAGCGCAAGGTCAGAATGAGGAAGGCGAAGATGGCCCTTAAGCAGTACATCAACAACCTCGAAA ACCTGAAGAGAAAGGTCTTCCTCCAGGGAAAGGAGGCCGCAAAGCTCGGCGACGAGGCTCTCCTAAAACGGAGTGCCATG AAATACCTCGCCCTGGAAGAGAGGATAAAGCAGGCAAAGAGGCTTCTCCTCCTCATGGAGGAGGCCGAGATCCAGAGGGA ACTCGTGAAAGTGTCGGCCAACTTCATCCAGTTCAGCAGGGACATCGTTGAGAGCATAGCCGAGGGGCCCGGGGCGGAGG ATGTGGCCAAGATGCAGGTTGAGTTCGAGAAGGCAATGACAAAGGTCGAGGGGCTCGATGATGCTCTGAGCACGATGCTC GACCTGACGAGCGAGAGCATACTGACCGGAGACTTCGACGCCGAGACCATAGAGGAGGCAACTTCGCTGT