

>tg0972 ATPase of the AAA family

>tg0972 ATPase of the AAA family

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 913146 - 915345 (Additional range around tg0972 is :500nt.)

>Thermococcus gammatolerans EJ3 GGAGGCCTTCAGGCGGGGCGGACTCTACGACAAGGCGAGTGCATATTCCGTTGGGGAGTGGAGGGTTCGCGGAAAGCTCC AGAGGGTGGCCCATCTCTCCCCCGACCCGGAGGAGGTTCGGGATTTCGTTCCCCTCTCCTCCAGAACGGGAAAGAGGTGG CTGATTTTCATAGAGGGCAAGCTCAGATGGCTGGCAAACGTGCTCTACCGTCTCACGTCGAACTACGGGGAAAGTCCCTG GAGAATCTTCGTCTCCACGGTGTTCATCATCGCGCTCTACTCGTTCCTGTACTGGATAACCGGGGCGGTGGGGAGCTCAT CGATGGTGGAGTGCCTTTACTTCAGCGTGGTGACCTTCACCACAGTCGGGTACGGAGACGTGACGCCGCTCCCCGGCTAC AGACTGCTGGCCGGGAGCGAAGCCTTCATAGGAGCGTTCCTGATGGCGTTTTTCGTTGTTGTGATGAGCAGAAAGCTGAT CCGTTAGGAGGTGTTTGAG atgcccgtcgatctgtccggacccctgatgtcggcctttaggaaggccaagaaggagttt gaggaggcaataaagaagggcgataaggagaccgccaaaaagaaggcccttgagtgcgcaaggatactgaagcagctctc aaagtacgacgagttcaaccgcgagagctacctgaagaaggcgaagaagtgggaggccatagcgaaggaagtcgaggagg gtcactacggcgtcaaaaggaagcagaaaccgataaaggagggtggaaagagtggcaggggaggaagcgaagcgggcgca gacgagggagaccagttcaagcgctacgtggagaacctcattgccaagtcgaaggtgaagtggagcgacatcggtgggct ggaggaggtgaagaggctcataatggagacagtcgtcatctcggccctgcagaggccccagtccatccagccctggaagg gtattctgctcttcggcccgccgggaactggtaagactcttcttgcgagcgccgccgcaggaagtttgaacgcgaccttc ttcagcgtcaaggccagcaacgtgctgagcaagtacttcggtgagtccaccaagataataacagccctctacgaggtcgc ccgcgagagggccccgagcatagtcttcatggatgagatagacgccctaacgaccaagcgctccggtgagcagagcgagg cgagcaggaggatgctctctacccttctcaccgaactcgacggctttcaggacaagaagagcgatattcttgtcctaacc ttagccgccacgaatactccctgggacctggacgaggccgtcctgtcgaggttcccgaggaggatctacgtgcctttacc cgacaagaaggccacgaaggagatcatcaaaatcaacacgcgcgggctggacataagcaggctcgacctcgatgcaatag cggaggagagcgtcagaaggctttactcgggcagggacatcaagaacctctgccaggaggcggtgtggaacatgattcgc gaggagaacccggacctccacaagctggcggaactgccctacgagaagctcaggaggcgctcgctgcggacgagaccgct tgagatgagggactttgaggaggcgttcaagaagatcaagagcccgctgacgcggaaggacattgaaagatatgagaagt gggcggaggagtttgggggg TGATTTTATCTTTTTAACAAATTAGGGTGATGCTTGTGAGGGGTAAGGATATGATCTCT ATTATGGTAGTTCTGTTAGTCATACTCTCTGCGAGTGGATGCTTGGGTAACACCAAGAGTGATCATGGATGGACACCAAG TACACCAAGCGATACCCCTATTCTAAAAACTCTCTTTGAATCCGTAGGACAAACTCACAAGGAATTTTATCTTGATTCGG ATTCCACTATAATTATAACAATCAAGTCCAGTTTCAACATTGAGAACACTTCTTTCAGGTATATAGGCATAATACCCTCC AAGGAACTAATGAACTGGGAAAAACATGTCTTCAATCCAAGTCTTGTCAACTTTTCGTGGATCATTTGGAACGCAAAGGA TGGAAGTTATAGAGTTCACCTCCAAAAGGGGGAATATTACTTTGTGTTCGGGGGAGTACTGCCCAAACAGAAGTATCTAC TGGGGGATACCGTGGTAGTAAAGTCCTACAAATACCTCGCC