

>tg0973 Voltage-gated potassium channel, putative

>tg0973 Voltage-gated potassium channel, putative

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 914361 - 916485 (Additional range around tg0973 is :500nt.)

>Thermococcus gammatolerans EJ3 CTGGAAGGCTTCCCTTCGAAGGAGACGACCTGATTGAGGTCGTCTCAAGGATAGCCACCGACGAGCCGATTCCGCCGGGC GAGCTCAACCCCGAGGCAAAGGACGTCGAGCACATAATCCTCACCTGCCTGCGGAAGGACATGGAGGAGCGCTACCAGAG CGTTGCGGAGCTTCAGTTCGAGCTGGCTACCTATCTCGGCGTGCGCTATAAGAGAGAGCTGAAGCGCTCAATAACCGTAA ACGACGCCCCGAGGGCGGCCTTCTACGCGGGCAAGCTGATGCTGATGTTCCTCAAGATGGGGGACCTCAAGGAGGCATAC AAGTACGCAAGCGACCTGAAGTTCTACGCGCGCGGAGAGCTCACAAAGGACGTGGAAAGCTTGGCGGAGCAGATTAAGCT CAGACTTGAGGAAGGCCTGAGCTTCGCCGGTGAGGAGCTCTTAGCGAAGGCCGAGGTAATAGCACACAAGGTGAGCCTGG GGTTTGGGGAGGTGTAACG ttgaggtgcgcctatgaatactcccactcggtgaaggaatgcccgagagaggccgtgggt gatctgccctactgcatcttccacctcccggaggggggaaaggacttcgagggagcgatgctggaagatgaagacctgga ggaggcctacctcagcgaggcgaacctcaggggtgccaggctcagcggtgcaaaccttcggtgggccgacctgagcgatg cgacactcgacaacgcagacctcagctgggcgtccctcgttggggcggatttgagcggtgcgagtgcccgggaagcggac ttcacccgggcggatttgagggacgccgacctctcggcggccgttctggagggggccaacctatcactcgcggatctcag gggcaccaacctgatcagggcgaacctcaggggggttgacctgtacggggcgattctcgacgagaccaacgttctgggta cggacctgaggggggcgaggctctatggggcttccctgaagaacgtcagaaacctcgaaaacgccctcatcgacgttgaa gccgttgaggagagggaaggtgacaggctggtgggggagggcaacttaggggaggccattgcatcctacaaaaaggcctt gtcggtttaccttgtgctgaaggaggccttcaggcggggcggactctacgacaaggcgagtgcatattccgttggggagt ggagggttcgcggaaagctccagagggtggcccatctctcccccgacccggaggaggttcgggatttcgttcccctctcc tccagaacgggaaagaggtggctgattttcatagagggcaagctcagatggctggcaaacgtgctctaccgtctcacgtc gaactacggggaaagtccctggagaatcttcgtctccacggtgttcatcatcgcgctctactcgttcctgtactggataa ccggggcggtggggagctcatcgatggtggagtgcctttacttcagcgtggtgaccttcaccacagtcgggtacggagac gtgacgccgctccccggctacagactgctggccgggagcgaagccttcataggagcgttcctgatggcgtttttcgttgt tgtgatgagcagaaagctgatccgt TAGGAGGTGTTTGAGATGCCCGTCGATCTGTCCGGACCCCTGATGTCGGCCTTT AGGAAGGCCAAGAAGGAGTTTGAGGAGGCAATAAAGAAGGGCGATAAGGAGACCGCCAAAAAGAAGGCCCTTGAGTGCGC AAGGATACTGAAGCAGCTCTCAAAGTACGACGAGTTCAACCGCGAGAGCTACCTGAAGAAGGCGAAGAAGTGGGAGGCCA TAGCGAAGGAAGTCGAGGAGGGTCACTACGGCGTCAAAAGGAAGCAGAAACCGATAAAGGAGGGTGGAAAGAGTGGCAGG GGAGGAAGCGAAGCGGGCGCAGACGAGGGAGACCAGTTCAAGCGCTACGTGGAGAACCTCATTGCCAAGTCGAAGGTGAA GTGGAGCGACATCGGTGGGCTGGAGGAGGTGAAGAGGCTCATAATGGAGACAGTCGTCATCTCGGCCCTGCAGAGGCCCC AGTCCATCCAGCCCTGGAAGGGTATTCTGCTCTTCGGCCCGCCGGG