

>tg0977 Prokaryotic ATPase, AAA superfamily, disease resistance protein related

>tg0977 Prokaryotic ATPase, AAA superfamily, disease resistance protein related

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 920689 - 923026 (Additional range around tg0977 is :500nt.)

>Thermococcus gammatolerans EJ3 TAACGAAGGAGAACAACCGCTACTACTTCACCGATAAGCTCATGCGCTTCTGGCTCGCAAAAACGTACCTCGGCATAACC GAGCTTGAGCTGAGGAGGGAGAAGCTGCTCAAGGAGCTGGTGGCGGAGCTTGAGGAGAAGTACCTCAAAGCCAAGACGGA ACTCGGAAAGGCGGCCGAGTTCATGGTCAGGGAAGAGCTCGGGAAACGCTTTGGAGTGAAGTTCGAGCCCTACAGGAGGG GCGACGTTGAATTCGACGGCGTTGCCTTTGGCGGGAAGACCTACGTCCTCGAAATAAAGTGGAGGAACAGACCCGTTGGA GCGAAGGACGTGGAGAGGTTCGCCAGGAAGGCGAGGGCAGAGTTCAGGGAACCGGTTATGGTTATGTTCTCCCGCTCGGG CTTCACGGAAAAGGCCCAGAAGGTCGCAGAAAGACTGGGGGTGGTTCTGGTTGAGGATAAAATGCTGTAGGGAAAGTATT ATACTTTGGCAACATCATT ttgtgtggtgataccgtgttcgtgaacaggaagcgggagcttgagttcctcgaaaggaag tggggggaaaatggtgcacagctgataataatctacgggcgcagaagggtaggtaagacgatgctcctcaaggagtttct ggagggtaagaagggcgtttacttcctcgccaccgccgattcaatgggcgagaacgttaaaggacttgccgataagttcg gggagctgaccggaagaggatacttcagggaggttaaagactttggaaggctcttcctttatcttggggatgaaataaaa aaccagaggatcgccgtcgttctggacgagtttcaatatttgatgagccttgaaccgggaattttgagcgttctccaaaa ggtttgggatgagcaccttaaggatacagagatatttctcgtgctctgtggttcttcaataggattgatggagcgggtca tggagtacaagagtccgctctacgggagaagaacagggcagtggaaggttgagccctttgacataagaggcatagctgag atgcttcccgaggggagcatggaggagctcgtaaaggtctatgcggtcttcggcggcgttccattctacctcgacctcgt gaaagatttgagggttgaagatgccataagggagaaggttctgaggaagggcgaagtcctctacgaggagcccgagtttc tcctgcgggagcagctgagggagccgagggtttacaagctgattctcaagggacttgccctcggttacgaaacgctcggg gagctcgtgagctttaccggtcttgacagggggaacctttccaaataccttgacgtccttgagaggctcgacatagttag ttacgagctcccatacgggaagaggaagagggggcgctactacatcaaggacaacttcttcaacttctggttccgcttcg tgtatcccaacttagctgatttggagctcggcttgcttgatgaggtctgggcgaagattgagcgggagctcaacgcctac tacgggaggatgtttgagagacttatacgggagatgctccgccagaaaataattgacctcgagcagagaagggtcgcaag atggtggcacaagggcaaagaggtggatactgtggcggagcttgatgatggtctgctcttcgctgaggtgaagtggagtg agctgaagaggaaggaggccaagaggattcttgaagagctgaaggaaaaggcggagcgctttgagggcaaaaagaggttt ctgctcatcgccaagaggattgatggcaaaactggagagatgatggatttggatgatttggaaaggctggttaggggg T GAATGAATGGAGAAAGACTTCGAGATATTCCTCAGCTACTACACGAGAACGGGTTTAGATTATGCAGAAGAGCTCAAAAA GGCGTTGAGAGACAATGGATGGAAAGCATTCTTGGCACACCACAATATCCTTCCTGGGGAACACTGGAAGGACATAATTT TCAACTATGTTCTACCTCATATCAAATACTTCATCCTACTATACACTCCAGGTGCTGAAACAAGAAAATGGACCAGAGAA GAATACAAATACGCCAAGAGACTGGGAAAAACCATAATCGCATGTGTGTATATGCCAGTGGGGGAGAGTGTTGGGAATAT CCTCACCCGTATTGAGCCAGCATTTCCCGGAATCTCTGAGAAACAGGTAATTGAATGGAGGGATAAATCTGAGTTGAACT CAAAAGTAATCTTGACGTTGGAGAGATATCAAAAAAGAAGACTAGTTATTGGACATTTGTCCCAAACTCGGGATGTAATA CAACCAAAAGGCAATTCTC