

>tg0994 M28 family peptidase, Zn-dependent

>tg0994 M28 family peptidase, Zn-dependent

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 945983 - 948686 (Additional range around tg0994 is :500nt.)

>Thermococcus gammatolerans EJ3 GGACGAGGGAATAAAGGTGTACAACGAGGCGCCTTTCTGAGGTGGTAACATGGGGAAGAGCGAAAACAACGGGAAGGCCG AGATAAAGAAGCTCCTGCAGGAGGCCTACGAGTTCGGCTATTTCATCGGTTACAGGGGCCACAGCGAGTGGATATCGTGG GTGAGGGACAGGAAGGAGGAACTCTACCGGAGGGCAAAGGAACTTGGGGTCTACGAGCTCATCAAGAGTGCCTACAACAG GGGAAAGGTTGAGGGCTCAAACAGAAGGCAGGAGGAGATAAACCTCGGCCTGATCGAGAAGGGCAAGTTAACAGAGGAGA AGGTTAAGCCCAGGGTTGAAATGAGGAGGGCCGAGGAAAGAACTGGAGAGGGTAAAGGGCTCGAGGTCGAGTTTGCCCGC TTTCTCCAGACAACCAGGCTCGTCCTTCCCCCCGAGTTTTTGGACACCCTCAAGCACCTCGAAATACCGAGGATGCTCAA GTTGGGGGAGGAATGAGGT atgggaatcatgccgtttctcagggagtcggaggttttaagctccgaacggattctccac gacatcgttgagataagccagttccaccggatacagggttcaaaagagctcgttgaggccgttagatacattgaggaaga gctttctgcctggggagtttcgagcaggcttatcagggagaaatacgatggagagagctggtacctcacgctgaggtctc caatagcgtgggatctcgtgggggccgagatcgagttcgacgggcacagactgaactcctcaaggactcccctcgtggcg atggcccacagtccccccggagagggagagggtgaggttctgccgataatcagggaggaggactgggagagggccgaggg caaggtagttctcgtgggagagaactggagaaaagcctacagacgggccaatgagagcggtgcagctgcgttcctcgcct acaggaggggaaccggaagcgcggttccgtacataggcctgttcctctcgaaggacgatctcaaatgggcccggattcca gccctggccgtccctgagacgtgggcagaggaggcgatacgaaagcacctctccgggaagtctccaaaggttaagttccg ggttgaggtagaggtgagggaaagggagacccttccgatactctacgctgagataggagagccgccttacatactgttca ccgcccacatctgccatccaaggccgggcgccaacgacaacgcctccgggagcgcaatgctaatggagctcgcgagggtt ctgagccgcgtctggaacggttccttccgctttggcttcgccttcctctggatccctgagtactacggcacccaggcctt tgtgaaggaacacgcgaggatggaggattactacgccgttataaacctcgatatggtcggcggaagcgtggaccgctccg gctcaacggtaatggtcgtcagaactcccctctcgaacttctcagtcctgtcgggcatcatcgaggcctcactttccctg gcaaacatgaggggcggaaagagcttttcgggctctccgatgcctttgctcccggtgaaggcttatccttacgaaatggg gagcgaccacgatgtcttcaacttctttggcgtccccgccgtgatgcccataacgtggccggacaggttctaccactcca gtgaggacagcccggagaaggtaagcagggcgacactggatgtaatcggacggggtgtcctctcagctgtcctcttcctg gccaggggagagaaaaacgaccttcaacgcgtttctaggggctatgcaatgaagtacctcggggagctggcgatggagac cgaaaccgaggttgccgagagactcgtgatgaacggactcgcgagggattcgaggttccttggaattgatcttggccaca gctttgaggaaaagccgtggctcaagtggagcgcccgcggcaggatctcggtggagttcataaggggcagaaacacctcc ctggcggaggagtttgagaagctaactgaggatagaagggtcataacccatctccacgaactggtgatgctcggggagaa actacctgaggaaaaggcttacaaagccctcagggaggagtacagcgatatcaacgaggagaagcttgaaaggcttgaaa gactcgtgggaatactccttgagacgggtatcgtggaggggact TAGTCCGAAATCTCCTTCTCTATTTCGTTTATCCT CTGTATTATGCTCTCCTTTATGCGTTCTATGAGCTCCTTCGGGGAGGCGGCGGTGTAAACGTAGCCGAGCCAGCCCTGTT CGATCAGAGTTCTCTTAAGAACTCCCTTCCGGTAAAGGTTGAGAACGTGCTCCCTAACCGAGCGCTCGCTGAGACCCAAC TCCCTCTGTATCTCCGTGATTCTCATGGGCCTTTTCTTCTCGAGCAGAAGCTTGTACACCCTGAGCTCCGTTTTCTTGAA ACCGAGGCTCCTGAGCAGTCCTTCCAGCTTCTCGTAGACCTCGTCCCTTGCAACCATGCATTCACCTCTATGAAGTTTTT ACTTCATGGCCCTTAAAAGGCTTACGGACTTAAGGGTTTTTGTGGAAAGAGTTGAGAAAAGGCACAAAGTTACTGAAAAA GATTTCAATTTTTAGGAGTTTCCCCGAAAATTGTCTGAGTGTGGGCCGGGCACAGAGGCCCGAGC