

>tg1015 ABC-type Fe3+ transport system permease component (fbpB/AfuB)

>tg1015 ABC-type Fe3+ transport system permease component (fbpB/AfuB)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 965009 - 967679 (Additional range around tg1015 is :500nt.)

>Thermococcus gammatolerans EJ3 CTCCGGCGCGGCCACGGCATGGGTTTACGGCATCAGCCAGAAGTACGGATGGGACTACTTCAAAAACGCCAGATCAATGG GAATCGTGGTTCTGAAGAGCAACGGCGCGGTTAAAAACGCGATAATAGAAGGCCAAGACCCCATTGGCGTGACGCTGGAC TACATGGTTAGACAATCAATGGAGGAGGGGGCACCTATAAACTACGTCTACCCCGAGGATGGAACCGTTGTGATACCGAG CCCAATAGCGATAATGAAGAGCACGAAGAATCCAGATGCGGCTAAAGCCTTTGTAGACTTCCTGCTCTCAAAGGATGTTC AGGAGTTACTGGTTCAATACGGCATAATCCCGGCCAGAACTGACGTTACACCACCGAAAGGAACGCCCAACGTGAGTGAC ATACCCAAAATCGACATCGATTGGGAGAAGCTCTCCTCCCAGCTCGAGGACGTCAGGAATCAGTTCTCCCAGATTATGGG CTGATTTCCTTTTTATTTC ttggagggagctaaaatggagaggaagataacgttcacccaggcaatgtggctgttctca ctggtggttctcctcgtaacgatagcctatcccctcgtggcgctgatatacaagagtctcttcggtgagaagggctttgg gtacgcctataaggtcatagcctcagacccgaacacgtgggtttatactctcaacacgctcaaacttgcggttatagtga ccttctttgcggttatcataggagtcccgttagccttcctcgttgtcaggacgaatctgcccgggagaaaggtggttcgc tttcttgcagtcctgcccttcatcctgccaccctacgtcagcgccatagcttggatccagctcgcggcgccctacgttgg atacataaacaggatctggaacgggctggggggaagcggcaacatagttaacatatactccttcccgggcctcgttctcg tcatgacgctcaagttctacgtttacgttttcctcacagttgctgcggcccttgagcagatggatccatcgcttgaagag gccgcaaggatgagcggctctgggccattcaaagtcgcaaaggacatcacaatacccctggtgatgcccagtatagcctc gggagcgctcctggcctttgttgccacgtgtgcgaacttcggcattccagctctcatcggggacagggcccactactacg tcctgacaacgaggatttacagcactctttcgattcccgatatagaccgcgccatagcctactccctgatcctcgttatc ataaccggactcgccctgctcattcagaagagatcctttggacagaagaggtacacgaccctcactggaaagaccgtaag gccagcggtgatagcactcggccggcgtaaggggctcgtggcacttttcgtcttcctgttcctggccttaacctccgtga tcccgcttttctcactgttcttcagcgcgttccttaaaaacctgtactcaccgcttaccagcctttcctccttcaccctc agcaacttcaagttcgtcctgatggaagacgaaacaacgactgcggcgctgaagaccagcgttttctcggcatttactgc ctcaacgatagttacgctcttcggagccctgctggcatacatgatcgtaaaaaccaacgtgaagggtcgtctcttcatgg actggctctcctcggttccctatgcccttccaggaactgtggtcggcgtggccataatcctcgccttcatcaagacacct atcttcaacacactgtggataatacccttcgcttacttcatcaggtacctttcctacggtgtcaggacaacggtcggttc cctgctccagatagacagaactctcgaagaggcctccctgatgtgtggtgcaaactggctcacgacgatgaagaacatag tcctccccctcattaaacccggcctcatagcggcatggatactggtcttcatgcctactctcagtgaactgacggtctcg ataataatctatcctccgaaccaccccacgattggtgttgccacctacaacctcatggaggagggtcagtacaccgcagc gtatgccctctccgccgttgttgcggtggttgttattttggtccagctcgcggttaataagatcacaggaaaaattggag caagggggttg TGAAATTGGCGGGAATACGGCTCGTTAATCTGGTTAAGAAGTTTGGAGAGGTTACCGCCGTCAGGGGG ATAAACCTCGACATTAAGGATGGGGAGTTCATGACCCTTCTCGGTCCAAGCGGCTGCGGAAAAACCACGACGCTCAGAAT GATAGCCGGTCTGGAGGAGCCCACCAACGGTGAGATTTACATAGGCGACAAACTCGTGTCCTCCCCGGCCAAGGGAGTCT TCGTGCCACCAGAAAAGAGGAACATAGGAATGGTTTTTCAGAACTATGCGGTCTGGCCACATATGACAGTGTTTGACAAC GTTGCGTACCCGCTGAAGATCAGAAAGCTGCCCAGAGAGGAAATAGAGAGAAGGGTTAAACACGCACTTGAAATGGTTCG GTTGAGGGGTTTCGAGAAGCGCTATCCCCATCAGCTGTCCGGTGGTCAGCAGCAGCGCGTCGCCCTCGCAAGGGCGCTCG TTATGGAGCCCGAGGTTATGCTACTCGACGAA