

>tg1021 FAD/FMN-containing dehydrogenase

>tg1021 FAD/FMN-containing dehydrogenase

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 971312 - 973805 (Additional range around tg1021 is :500nt.)

>Thermococcus gammatolerans EJ3 CGAGAAGCTCGGGAAGGAGAAGGAGAAGAGCGTTATCTACTGGGCCTACAAGAGAAACGTCCCAATTTTCTGCCCGGCCA TCACCGACGGCTCGATAGGTGACATGCTCTACTTCTTCAAGGAGGAGCGCGGAGATAGAGAGCTGATAATTGACATAGCC AATGACATCGTGAAGCTCAACAACTTAGCGGTTACCGCCAAGGAGACCGCCTCGATAATTCTCGGCGGCTCTCTGCCGAA GCACGCGATAATAAACGCCAACCTCTTCAGGGGCGGAACCGATTACGCGATTTACGTGACCACCGCAATCCCCTGGGACG GCTCGCTCAGCGGTGCACCTCCGAGTGAAGGTGTAAGCTGGGGCAAGATAAGGGCGAAGGCTGACTACGTAGAAATCTGG GCCGACGCGACGCTGGTCTTCCCCCTGCTGGTGTGGAAGGTTATGAGGAGCTGATGCCCTTTTCTTTCCAATCTCTCTGA CCTTCCTTCTTGTCTGCACT gtggctccccaagtgctccaaaatgcttttatttgtgcatgcaatatgtgcatcagggg tggaatcttgacgctgacgtttgatgaagtccttaagcgccccaaaaggggcagcgttgatgaagccatcgccgaactca aaaatcttcttggggacaaggtttcgaccaagccggctgacctcttttcgtacagccacgactactggctcataaccttc cactggttgctgaagggtaaagttccagcgcttcctgatgcggtggtgtttccggagagcgaggaggacgttgtgaacgc agttagggtggctcacgaaaagggcgttcctctctacccatacggcggcggctctggagttctggggggaacagtgccgg agtacgggggcatagtggttgacctgaagcgcctcagggatttgcggctttatgaggatgaccttatggtcgaggccggg gctggagtcaacgggtattacatcgaggagtacctcaacagacggggctacacactcggccactttccgcagtcgctcta tccctcaacggtgggcggctgggttgccaccaaggctataggccagttctcgaccagatacggcggcatcgaggatatgg tgcttggcctgagggcggtaattccgccggggaagctcatcgagctcaaaccacacccaaggacggcaacgggcccggac ctgcggaagctcttcgttgggagcgagggaatattcggcatcgtgacgagggtgtggctcaaagttcgtccctaccctga ggagcgctttctgctctcctttgcatcggagagccttgaggaggctctggactcagtcaggcggatactccaccgcggtg cgaggccggcagtggtgaggatatacgaccgggtcgaaacgaagaggcacttctacaaattcgaagagctgtacggaaag atagggacggtcatcatagtcgagggggactccaggctggcaagggccgagaaagaaatcgtcgagagggagttcaaagg ggtgcctgccggggaggaacccgtgaggcactggctggagacgaggttcaacgtgaaggagatatccgagttcgcgccga tcggcgtggtcatagacacgatagaggttgcggtaaactggagcagggctgcggaactttatgagaacgtcatcagggcc atgaagtccgtgaagggcacgctgatggcttccgcccacgcttcgcacttttacgaccagggggtctgcttctacttcac ctttgcgggcgttcccccgaggggcagaagcgcgggggagttctacaacgcggtctgggatgccgcaatgagggccacgc tcgatagtggaggcacgataagccaccaccacgggataggccgtcacaggcggggatggctcgcggaggagctgggagat gcctacgaggtgctgaggaaggttaagctcgcgatagatgagaaggatgttatgaaccccggtaacatggtgatg TGAA TGCCTGGAAAGTGGGACTGGCTCAAGGACGAAATCGGCTTCTCGAACCTTCTTACAGGCGGAAGGATGATCTTCAAGGTC GTTCAGGGGAAGCTCTCGGCGGATGACCTGACCAAGTGCGCCCTCTGTCCCAACATGTGCCGCCACGCCTGTCCAGTTTC GATAGTTGAAGGGCGCGAAACGACCTCCCCCGCGGGAAAGGCGCGGATCGCGCTCATGATACGCGAGGGACGGCTCGAAC TGAACCTCGACAACCTGGAGCCCCTGTACACCTGCCTCGGCTGCGACCTGTGCACCCTCTACTGCCCGTTCGAGTTCTCG GTCGCCGACCTCATCCGGCCGGTGAAGGAAGAGGCCGTGAGTAGGGGCGTGGTGTTCGAAGAGTTCAGGAAAGTTTTTGA AAACCTCGAAACGTCGGGAGACATCTACGGGAACGCTGATTCGGGTGCGGACGGTTCGGGGAAAGTCCTCTACTTCAGAG GCTGCACCGTGAGGA