

>tg1029 Predicted DNA-binding protein containing OB-fold nucleic acid binding domain

>tg1029 Predicted DNA-binding protein containing OB-fold nucleic acid binding domain

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 980273 - 982556 (Additional range around tg1029 is :500nt.)

>Thermococcus gammatolerans EJ3 ACCTGCCCCGTGAGAGAATAGCCTTCATGTTCTTGAGGGACGGAACCTACATGATGTTCCACGACGAGGAGTTCCTCTGC TACTCACCAAAGCCCGTCGAGGTCTCAAAGGAGGAACTTGAGCACTTCGAGAAAACCGGTGAGATGCCCGAGCTCGTGAA AAGGATCAAGGCCCACGACTTCCCGAGCGAGTGCGTCGTCAAGAGACTGCCCCCAATCGACGAGGATTTGAAGCCCTTTA ACCCCAACAGGAAGTGTGTGGTGATCTTCACCGGCTTCTGGGACACGGTAATAGACTACATTGAAAGGGCCGGAATCACA TACGCGGTCGCGAGGCTCGTGGACGAGCCCGACAAGGTTTGCCGGTTCGCTGGAAAGGGCAACTACAAGGTCGCGGCCGT GAGACTGAAGAGAAACCAGCCATGTCTCGACAGGGAAGAGTTCAGGAAGGTCCTCCCCAAAGGCGTTTGATTTTTAAGCC CTCTCTCTTTTCTCCAACC atgctcctccacatcggaatagacgacacggactcacccaacggcatgtgcacgacctac ctcggggcgctcctctaccgcgagatttcccgcttagctgaacccaccgaccttccgaggctgataaggctgaacccgaa catcccctacaagacgcgcgggaacggagcggttgcgatgacctttgaggtcgatgaggaggctgttccggaagttaagg acctcgtgctgttctacgtcaaccagctggcagacttcacccacgagaacaccaacccaggcgtcgtctttttcgagggc gaaatccccgaagagcttcaagagttttcgctcaaagctttaagggagcacgtaaccatcgaagaggctgaaagagtcgc gagggaagttggtgcggagttcttcaagttcaagctcggcaggggaataataggcgcgctcgcttcaattggctatcccc ttgagcgcttcacctacgagcttttagcttaccgcgagccggagaactgggggacgccaaggaaggttgatgcagagagc gtgtttttagcagacaggtggagctatcctttcacttacgacaacgttgacccctacaagagaaccatcttaatagcgcc tcacggcaaagaccccgttctagtcggactcaggggaattgaccggggaagggttctccagacctttgagatggtccgct ttggggagcccgttgccttctaccagctctacaagacgaaccagaacaccgacgatcaccttaccccaaagaaaatcggc gagctgaagctatacgacagcgcggtcgtcaggggaagggtttccaagccatactgggagcgcgggaggcacgttttctt cgagcttgaggacgagacagggaagatacgtgtcgcggccttcgagccgacgaaaaagttcaggaactacgttcggaagc tcctgcccggcgatgaaatcattgccgctggaggggttaaggagcacgagggcgttctaacgctcaacctcgaaaagttc tatccagtgaaactcgtcccgaaaatcgaatacagaaagcccaagtgcccgcgctgtgggggaacgatgaagagcaaggg cgactacctcaagtgcaagcgctgtggctacagaatgccgaaaaagctgattccggttgaagtccctcgcgagctggaga ggaagatttatgaggttcctcctgacgcgaggaagcatctgtcgaggccgctggtgctgccgggtggggaagagagagtt ttagaagccctagggaactcggga TGATAATCAGGATTATCATAATCGCGATTATCATTCGGGCCAATAGAGGTCAAGT CGGATGAGGCCATGAAGCGAGCGGAGGAGGACTTACTCAACCGGCTCGACAAACTCCTCGAAAACCCGGAGGAGAACGCG CTTGAGATAGCCTACACGGTTAAGCTCCTCAGGCTGGTTCAGTGGAGGGACGTGAAGGGGATAAGGGAATTTGCTAAGTG AGGTTGTAAAGGAATCCCGGAACCTCCGGGCCCTTCAGGATTCTAACGTCCCTCGGATACCTCCCCCTTCTCTCCCCCGA CTTCACCTCGACCTTCAGGTTTCCAGCGATTGCATCAACCTCGTAGGAGTTCCTGTAATAGTAAACCTCCCCGAACTTCC TGTACAGGTGCTCCTGGACGAGCCACTCGTAGAGAACCGCTTTATCAATCCTCCTCCTCGTCCAGAGCTCCATGGCCCTC ACGATGAGCGGGTCGCGGAGGATTAGCTTCCTCTCCTTCCGCGGA