

>tg1036 hypothetical protein TGAM_1036

>tg1036 hypothetical protein TGAM_1036

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 987685 - 990073 (Additional range around tg1036 is :500nt.)

>Thermococcus gammatolerans EJ3 ACGTGGGACAGGATTACATCTCCAGCCCGATAGTTCCTCCTCAGGATTGCCTCGATCTCCTCCTCGCTCAGCTCCCAGAT CGTGTGAAAAGGTGTTATATTTGACCCGCCGATGCCCACCACCCCAATCCCCCTGACTTCAACCCGCCTATCGTGGGCTG AGATCCCGAGCTCCTCAAGGTACTCTGGAACGTCCCTGCCATCACAGTTGCCGTGAACTGCCACGATCGGTATTCCCAGC TCAAGCAGAGGTCTTAGAACTTTCTCCGCAACGCTGGCACTCCCAAAGTTAGTGATGTCCCCGGCTATAAATATTGCATC TGGTTCCCTTTCCATCTTCACTATCCTCTCGGCGAGCTCTTCCGCGGCCTTTGAATCCCCGTGGACGTCTGTTACGGCCA CCACAAGCATTCCCATCCCCCAAATTCGCTCCATAGTCCACAACCCTTTTATATTTTTGGAACGTTTTAATTCCAGTCTG TTCGAAGGGAGGGATTGAA atgagaaagatgtcaaccctgatggccctcttaataaccggatacatcctgggagtgctg aactttcttctgatgccgaagtactacatcgccttcggtctcaagggctttgtcctgtctctcgtggcactcggcgttgg gctgatcctgatctacggcgagcttgaggcaacgcggaaaacgcgctacctcattcacgagttcatggtgaaggtctcaa ggctccccgcgatcaccataatcctgctgatgttcttgatgctctttggggcaataaacctgtactactccggttttgcc ctcatcaagctcttcgacctgggccccactatgctcattctactcctcctggtaatcgtaacgctgatatggctgttcct gataatactgaggggccgctccgtggagttcataggaatacttgcggtgctcttcatagtgtttgccttcgtctcccttt tcctgatgagggctcaagtttacgacttcgttagaagtgaaaccgcactgaactacctaaactcctacaggcacgcggtg ttatcctttgatcaccctctaactgcaaggggcacgataatgatgctgatcacggttctgctcagcctcggtctcggagc gggtgtttactacgtcctcggaagctttgccccatcagacctcgatttcaggaagctcctcgctgtcgtgcttctcctcc agatactgctgagcttcactgccgctttcacgaccgtttacgcgattggggccgcgtaccagagttatgagaccgccttt aacaacccccaaatcccctcggagaagtcgatgaagctctttatggacttccacaagcttgaagactacggaggcaaaag taaccaaagcccgattaaggccatcgagaccttctatctcatccccgacataatccgcgagagtggcatcggtggaagct cggccataatcttcctccttatgggatcgctcttcctcgcagggttcacgacgctcatagtgctcgttgagataggcgcc cagatctcggcggagatgtttcagatgaagaggaacacgagcgtctccttcgtcagcgggatagtcttaattctctccgc tgccatgatggtaagcgggatcaaggtgatgttcctagcggccctcttaggcgtaggtgggttgataatagccctcgagg gtgcacctctgctggtaggcgtctcccccgttgatcggagactcatcggagtcggagtgctggcctcagcggtgataggc ctcatatccctgaggactatgctgagcttcaagggttcctacataccgctgggcatactggtgggcctgctgctcttcct accgatgctctttaacaactatctgatggcaggctccagaaggggccgc TGAGCCCTTCAAAAATTTTTTAAATGGCCC TTCCGAGTTGGAATAGAACGCTTACGGGAGGTATGAGAGATGGGAGACAAGACCAAGGTTCAGGTCAGCAAGCTCAAGCC CGGGAGGTACATAATCATCGACGGCGAACCCTGCAGGATCGTGAACATAACGGTCTCTTCCCCTGGAAAGCACGGGTCCG CCAAGGCCAGGATTGAGGCCGTTGGAATCTTCGACGGAAAGGTCAGGAGCATCGTTAAGCCGACCAGCGCGGAAGTTGAC GTTCCGATCATCGACAAGCGCGTCGGTCAGGTCATCGCGATAACCCCCGACACCGTCCAGATCATGGACATGGAGACCTA CGAGCTCTACGACGTCCCGATCGAGACCGGTGTCGAGGACGAGGTCAAGGACCAGCTCAAGGAGGGCATAACCGTCGAGT ACTGGGAGACCCTCGGCAGGATTCAGATTAAAAAGGTCAGGGGCGAGTGAGCCCCTCTTTCTCGCTTCTT