

>tg1072 Putative phosphoglycolate phosphatase fused to dolichol-phosphate mannose synthase (pgp/Dpm1)

>tg1072 Putative phosphoglycolate phosphatase fused to dolichol-phosphate mannose synthase (pgp/Dpm1)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1023838 - 1026157 (Additional range around tg1072 is :500nt.)

>Thermococcus gammatolerans EJ3 TACCCGCTAACGATCGGTGGAAGGGATGGTTCGCTTCGACGAAAAGGACAGGGAGATCCTCGAAACGCTCCGAAAGGAAG GCAGGATAACGCTCACGGAGCTGGGGAGAAGGCTTGGTCTCTCCCCGGCCAGCGTCAAGAACCGCATTGACAAGCTGAAG GAACTCGGGGCGATCAGGGGGTTTTCGGCGGTCATCGACCCCTCTTTCCTCGAGCGATACGTGAAGGTGTTTATGCTCCT CAAGCTCAAGGCGGAGGATCCCGATGTGGACAGGGTACTCTCCAAGTTCGCCGCTCTTGACAACGTTCAAGCTGTCTATA GAACCACCGGAAGAACGCAGGTCCTGATAATAGCGGAGTTCGAGGACATGGACGAGATGAAAAGGTTCGCTGGAAGGTTA AAAGGTTCCCTTGGCTCGCTCCTCGAGTACATCGAGTGGGGCACGATATACGATTCACTCAAGGAGTGCTGGGTGACCAC CGGCAAGAGGGGAAGTTTCC atggacgtaagggcggttatatttgacctcgacggcacacttgtaggggcccccacacc cttctccgagataaaagagcgcctcagagagcgtctgctggagatgggaatagaggagaacctcctgggcgatctaaccc ccatgtacgaaaccctcctgaaagtctcggagaaaactgggattgacttcgaaaggcttcactcaattcaggtcgaacta gaaacggaacgcatgagggagagtttcctctttgagggtgctttggacgttcttgaatacctccgggggaaaggagttaa aataggtctcgtaacgaggagttcgcggaaggcggctgaattcgctttggaaaagaacggcatagcggagtactttgatt caatcgttgcgagggaggacgttcagccagaggagttgaagccaaaccccgggcagattctaaaagccctctccgagctc aacgtcccccccgagaaagctatagccgtcggtgatcacggctacgatgtcctggcgtcgaggaaggcaggaacgctgag cgtgctcgtaacaggtcatgattcagggaggatgagcttctccgtggaagccgagcccgactttgaggtttccgatctga gggggcttaagggcctgctcgagaggctcttctcaacttacgtcgtcgttcctgcgtacaacgaagaaagggcccttcca gcggttctcaacgacctgctccgttactttcgaagggaggagatagtagtggtgaacgatggatccagggacaggacgag ggagatagcggaatcctacggggttcacgtgctgaaccatctcgtcaacaggggactcggcggggctctcggcacgggaa tagcgttcgcggtcagaaggggggcagagctcattatcaccttcgatgccgacggccagcatctgctgagcgatgccctc agggttatgagaccagtggccgagggaaaggccgacttcgccgttggctcaaggctcaagggcgacaccagcgagatgcc cttcgtcaagaagttcgggaacttcgttctggatgcaataacggccatcttcgcgagaaagtacgtgagcgacagtcaga gcgggttgaggtgcctcaacagggagtgtgcatcgaagatccgcataacctgtgatcggtacgcggtttcgagcgagata ataatagaggccgcaaagcatggttgcagaatcgttgaggttccaatcaaagcggtctacaccgagtactccatgaaaaa gggaaccaacgttcttgaaggcgtaaaaatcgcactaaacctgctgtttgacaaactgagg TGATGGGGATGTATGCGG TTCAGATAATAGCCCTCGCGGCGATAGTTTACCTCCTCGTGAGGATAATCAACGACTACAGGCGGGGAAGGATAGACTGG TACGGCTTCGTTTCGTGGCTCATGATATTCGGCATTTTCGCAGTTATCGCGGTCTTCCCGGTCAGAATTTCCCTGGAGAT AAAGGGTCTGCTGGGACTCGGCAGGGGTCTTGATGCGCTCTTCGTGGTCTCGATAGGTTTGATATTTCTGCTTATGTTCC AGCTCTACGTCGAGATCGACAGGACTAAGAGGGAGATAACTGAACTCACGAGGAAAGTTGCGATAGAACTGGAGGAAATA AACGAACGGCTTAAAAAGCTTGAAGAGCGCTAAAAGTCGTCCCCAAACAGTTCCTCCAGAAAGAGCCTTACCCTGTCCTT GGGCAGTTTGAACTGCCTTATCTTTACTATTCCCTTCTCCTGTGCCTCCTTCAGCAGTATCTCCGTCGCCTCGTTGGGAT A