

>tg1084 hypothetical protein TGAM_1084

>tg1084 hypothetical protein TGAM_1084

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1032261 - 1034232 (Additional range around tg1084 is :500nt.)

>Thermococcus gammatolerans EJ3 CGGCCAGTTGTTTCGCTTGAACTTCTCAACATGCTCTCTTCGGAACACGAACTTCACTCCGTACCTTTTCTTGAAGGGGA GTTTAAGGGCATTGTAGATGAAAACGAAGGCAGGATGCCTGACGGGTCTATCCACTGGTGTGAGGGCCCCTGTGGGGCAG GCTTCAACGCAGATGTAGCATTTCCTGCACTTCTCGGGATGGGCCATGTAGGGCCTCAGCCTGACCTTGTATCCGAGGCC GAAGAGACTAACTCTCATCGGCACGACCTCCCATATCTCCTCCCCGAAGGGACAGGCGGAGATGCACTCTTCCCCTCCGC CGCACAGGGGGTAGTGTATCGTCAGAGGGGCCGTTTCCTTCATCCTCTCGTGGTAAACCCTCCAGTCCTCAGCTTCCATA AGACCACCATGCATGTCTGTATTCGACATATCGCTGGACATATCGTTTATAAGCCTTTGCATGAGGAAAGGATTAAAACC CCAGCGACGTAGTTAAGGCG gtgaagcgaatggaagaccttctgaaggctttggaggagaaggacacgaaaaaagtggc aagtctgctctactacaagatcgacgagctcagcgatgagcagcttgaggaggttctggaaaaggccgaaaagctcgcgc tggagaagaaggactacgagctctacaagctggtcgtctactactaccacgagttcctggaggttgacaagataagcgag ttcgaggagcttgccgagaaggagggcacctttgaggcaaagttccatttagcggacctttacttcctcatcggagagct ggagaagagcctcgcgatgtatcaggggctcattgaagaggagatcacgaagggcaacctcgagcacgtggcggagatct accacaacatggccctcatcgaggaggagctccaggactacgaaaaggcctacgaactgcttgagaaggccgaaaagaac taccgcgagctgggggatgaggaaaaactgctccacgtccttatttacaaggcctacgtgaagttcgagatgggagacac ctacgaggccaaggctatgctggctgaactgttgccgcgcattatggagattggagacaggaggcttctcaccgaggttc acctgagctttgaggagatgtttgaagaggaggataactacgacgccgccctgcaggagtgcctgtactcgatgctctgg gcccggggaaccgagtactacgacgtcgccttcgatgccctcgttgatgtcttctggcagctcttcctcgaggacgactt cgagaggatatacaacaacgccgacatgttcatccgcgcctttccggatttcggagcgttctttgagggggtcaagtatc tggccctcttcaaggacggtaaagtgaaggaggaagagctcaagaaggtcctcgaaaaggtcgaggataggagactactc gatctcctcgagttccttggagaggccgagctc TGAGGCCCACTCCACCATCTTTTTTGCGATCGGGTCTCTTCCCCCA AGACGCCCGTAGAGGCGGTAGTTTCTCAGCATCCTGCGGTAGAGTTCCAAGGCCTTTTTTCCCCGCGCAACCCCGAGCCT CGTGAAATCAACCGCCATCTCAATCAGCGCGCAGTCCGCACGGCTCATCGGCCTGGGGGAGAGCGAGCCCTCTATCTCCC CGACGGGGGTCATGGTTGCATCGAGGACACTCGTCGTCCCGATTTCATCAGAGTGCTCCTTTGTTTCCCACTCAACATCT CCGTAGAGGCCGGGAAGCCCCTTCACCCACCGGTATTTGCCTGCCTCAACGAACCCAAGCTCCTCCTCGGGTGGGATGTT TAGTGCAAGCCGAACGATCAAACCGGCGTCGTTGGTAAACTGAATTGAAACGTGGGGATGTTCCTTTATCTCCTCGGCGC TCTTTCCCCCGAAAAGCCGGAAGTGGAGCTTTGAGCCTTTCCTGACGACGCCG