

>tg1107 Sugar-phosphate nucleotydyltransferase

>tg1107 Sugar-phosphate nucleotydyltransferase

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1053026 - 1055264 (Additional range around tg1107 is :500nt.)

>Thermococcus gammatolerans EJ3 GTTACCACGCTCTACATACCGTGCATAGCCACCATCGGTGCCGTAAGGGCGGAGAGCAACTGGAAGTGGGCGCTCGCGGT CACGGTGTACATGATAACCGTTGCCTCGCTCCTCGGAATCCTGATATGGCACGTTGGAACGGCGCTGGGGTTGTGAAGAT GGGCAAGATGGAGGAAGTGCTGAGGCTCATCAACGAGGGCAAGCGGTTTCCGCAGGAGATTGCCGAGGAGCTTGGAACTA CGGTCGAGGAAGTCGAGGGAATCATAGAGCTCCTCAAGAGCCTCGGCTACATTGAGGAGATTGAGCAGGGGCCCGCCTGC GAAACCTGTCCGCTCAGGAAAATCTGCTACGGGAAGTGCCTCGTGCCGAGGGTGAAGGTGCTTAAGCCAAGCTTTGGAGT TCGGGAAAGGGAATTCACGAAATGAACGTCTGACTTTTTGCTTTTATTTTACGCCCGTAAAATATTTAAGCTTCCCGCCC TATATGGTGATGGTGATACC atgaaagcggttattctcgccggtggatttggaacgagactcaggccactctcatcaac gagaccaaagccaatgattccagttctcgggaagccaaacctccagtacatcctcgaggcactcgagaaggttcctgaga tagacgaggtaattctctccgtccactacatgaggggtgagataagggagttcatagacgagaagatggcagattatccc aaggaaatccgcttcgtcaacgatccgatgccccttgagacaggcggtgctcttaagaacgttgaggagtacgtgagcga tgacttcctcgtgatttacggcgacgtcttcacgaacttcgactaccgcgagctcataaaggcccacgaggagaacgacg ggctgataactgtcgcggcaaccaaggtctacgaccccgagcgcttcggagtcctggagatggacgagagcggaaaggta ctacactttgaagagaaacccaagaggcccaagaccaacctcgttgatgcgggaatttacgttgtgaacaagaaggtcct cgaggagattccaaagggcaaggaggtctactttgagcgcgaagttcttccgaggttcgtcgagcgcggtcaggtttacg cttacaggatgccaaagggaacctactgggttgacctcggaactccagaggacttcttctacgcacaccagatagccctc gacgagatggcgagggagaacggatacttctacatagcagagagcgccgaggttccggaggacgtcgaaattcagggacc ggtttacatagacgagggcgtcaaagtaggacacggcgtcaagatcaaggcctactcctacatcggcccgaacactgtaa tagaggataaggcctacatcaagcgctctgtcctcataggaaacgatataatcaaggagcgcgccgagctgaaggacacc atactcggcgaaggtgtcgtagtgggcagaaacgttatcataaaggagaacgctgtcgttggcgactacgccaagataaa ggacgatctcgtgatctacggcgccaagatactgccctggaagaaggttgaggaatacgaggcctacatcaagataaagc ttgacccgacgaaggtcaggcccggccagtatcccgaccgctgcccgctcggccttccggagtgtatctacaagaagttc aaggcgatagccggcgagaagccgccgtgcgacgagtgcattgagaaccagtggctcttc TGAACTTTTCAATATTTCA TCCTCGGGTTGTACTCGAGGAGCATCATCCCGTTCTTGAAGATCCTTATCGTCCCGCTCTCAGACAGGCTTATCGCCGTT GCCTTGGTCAGTTTGGTTATACCCGCCGCGGCTATGTGCCTGCTTCCCAGACCGGGGGGAAGTCTGAGGTTGAGGCTCTT TGGGTCAACTTCCAGATAAACTCCCGCGGCCAGAATTCTTCCCCGTGAGCTTACTATGAAAGCTCCATCGAGCTGGGCGA ACTCCTTGATGATCTCCTTGCTTTTTCTGTCGAGAACGTTTATCTTGTGCCCTTTGAAGGGATTTGGGAGCATACTGTGG GAGTGCTTCATGACGTTCTTGACGTCACCGACAACGAAGAGCGTACCGATTGGGTGTCCCTCCCTTCCCTCGATGCTCAG TTCAATTGCTATCTCAAGGAGCCTCTGGACTACGGATTGAGAGTGTGAGAAGAAGCCGTTAACGGCGAACAGGTTCTTTT