

>tg1114 Membrane-bound dolichyl-phosphate-mannose-protein mannosyltransferase

>tg1114 Membrane-bound dolichyl-phosphate-mannose-protein mannosyltransferase

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1059786 - 1062984 (Additional range around tg1114 is :500nt.)

>Thermococcus gammatolerans EJ3 CTAAGGACACATCGACGAACGAGAGAAAAGCTGCCGCCGCCCTGAGGGTCTGCAGCGATTTGATCCCCGGCAATACCGAG AGGTACGGAAGATACTTTGTCTACGGCTTTGGAAAGAAGTACTTTGGCATAAGGAGGATGTACCTTGAGGGTTTAGATTA CGCCTGGATAAAGGGCAGAAAGGGAGTGATAGGATTCGCTCCATGCAGGGAATACGGAGGTTTCGTTATAGACCTCTATT CTCCCCAGAGCCAGTCTCTGAACGTTACTGTAAACGGGAAACTGGTGGGGGAGTTTAAGCTTGATGCAGGAGAAAACAGG CTCAATATCCCAGCTGAACTTCAAAAGGACAGGGTTGTCTTCTTATCCATGTCCTCAGAGAAGGGTCCTCTCTTCGTGCG GTTCATTAAACTGCTTCCCCGATCTTGAGCTCGGAAAGGTTTATTATTTGTCATCTTAGAATCCTCACGTGATCTCAGGT TTCCATAATGGGGGGGTAAC atgaaggctgaaaccaaaaaaatcctgtcgctctcggtgttaatcctgtattacctgct gacccgcctatggaacatgtcgggaacaatgaacgagtacttcgactacgatgagggaacttacctgatgatcgcgaggc tgattaaccatggcgttctcccgtatagggacgtcttcgcagttcaccccccgctttactactaccttctggccctctgg ctgcgcctctttggggatagttacgttgttggaagactactctcggtttttctgggcctgctggcggttttggttgccta ctttgtcggcagagagcttcacgactggaaaactggagtcctcttttcggcggtcgtggttatggatcccataatggttc acatgaacggcctcgtgtttcatgaaactacaattgagctttttaccctgctttccttgtaccacttcgtcaggtacgtg aagctcaggaacaggaaagacgccctctggtcgcttttttggactggagttggcagtacgtcgaagttcacgataatccc ttatgctgtggccctatacgttgtcctggtacttctcgtcgacctggaaaccgaatcttaccttgagcgcctgggcaggc ttctgctcaacagggttcaggtttttctggttctcgccgcctacggcatcatgtcccttctaattgtggacacgatactg atttacccctccgatggactgagacgcctctttatcttaccaggcgttcacaggataggactcgtcgggcacatcatctc cgctggaattttcttgataatctggggcttcctgactctctatgtcttcagggtttcctatctccgaaaactggtacgct cacttcatttagtccttaaaaacctcaaaacagcccttcagtatctcctggtattcctgcttccgaaagtcctgatagaa ggtgctctcgggctgggtgtaagcagggactacctcaaccagacatatctggctcagagttccaggtacgctcccctagc aggggtttttgaccttctcgcaaatctctttgagaaatttggggctgaaaaacctgatttcgttgttttttatcttccgc ttatctttatgttcaccctcctcctcttttacttcagccgcggggagaagcttagggagccgtctgtcatggggcccctt ttcataacgtctttcgttacgtaccttctactgttcccaatcattccaaacatgaggttcctctatccgatggttctaac tgcctatctggcgttttttgagtcgatcttggaaagactggagggaagaaagctcgtggccttggtctttgcggccgtct tggtttttggggcggccgattatgggatggtttgcagttaccgggagggaaaacttctcattccctgggcaggccacagc aaagacctccgagatgacctgagcatgtacatcgggggaatgaacctcaccggaacttttctctccgtcaacccctttaa cgcctattacctaaacctcaggattgacccctattacctcgatacgtttgggatagtgtatatggggaactccagccggc tctgggaggccataaacgaaagcgactatttgctcttcagcacttggatgtacgccatcggcagggagtcaaaggtcttt gaggagacctttgggaaacttaaggaacacgccgttgttaacggatcccttctttacgccgagagctacggcaagggaga cgtcatagagctcttcaggaactccgaaaatcggtcccatgcagtcggcttctcgtctttctccggaaagcttcagttat gggtgaacggtagtgaagtggcatacatttacccctcaatcggcaacgtgagctacacttggagaaccgttgttgagagg aagcccagcggggggtacgaacttgtctattattcaagtgatggagactcgatcataggccatttaaagttggatgagga ttctctaactctgtcttttccggttgaggtgaacctgacggttgagttcaaagagagagtcgtgttcctccgggacggga agctcgtcaaaaatggaactcccggcgactttacggcgttttattcgggggggagcttttcagttgagagcaatggaacc gtgaagaggataaccccctccgggataactgtacagtgcatcggggttaggataaaggga TGATAAAAATCAGCCGGAG TTAAGATTTGAAGATACTTCGCTCCTTATTTTTTCGTTTAAATTACTGTCGGCACGGGATAAAGAATCGGCGAGCTTTTC GTGCTCACTTTTAATTATTCTTATGTAATGAAAGCCCCAAACAATGATAATCAGAACCAGCGCCACCATAAGCAGGTACT CAACAGCCCCTTGGGCCCTTAGTCTGCCCATAGCCTTACCTCCCGCAAGAAGAAAGAAATAGCAGAAATCATGAACTAAG AGCCTCGCTAAGCTCGCTGTTCACTGCGTTGTTTATCTGTTGCTGACCCTGCTGGATTGTCTCACCGGTGCTCTTTCCAG AGCTCTTTAGGTACTTGATAGCAATGGCAACGATGATAAGCGCTGCCGCAATCATAAACAGGTACTCGATTGCACCCTGG GCCTTCCTCATCATTCACATCACCTCCGGGAGGTCTTGTCAAAGTATTTAGCTTGAAATCCTTTAAATAGGTTTCTCCAT