

>tg1120 Aconitase X, putative, Fe-S cluster subunit (AcnX)

>tg1120 Aconitase X, putative, Fe-S cluster subunit (AcnX)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1064948 - 1067114 (Additional range around tg1120 is :500nt.)

>Thermococcus gammatolerans EJ3 CGAAGACGTGCAGAGCGCCAACACCGTCGTCAGCTCGGTTATACTGCCCCTCGCTTTCCCGGCGTTCCTGCTGATGTTCA TCGACCTAACCCAGCTGCCCCCAGTTGCCCGCTACATCCTTCTGGCAATACCGTTCACACACCCGATAGTCGGCTACAGG TACGCTGTGACAGGCGAATACTCCCCAATGCTCTTCAGTGTTGCCTACTTAGGAGCCATCGCCCTCGTGACTCTCTACCT GACGGCAAGAATCTTCTCCAGTGAGAAAGTACTGACTGCAAAGATCAGCTGGGGCAAAAGAAAGCGCTGAGAGATTAGAA TTGGAGAAAACGGCAGTTTGGTAGCGGGGGGAGGATTTGAACCTCCGACCTCCGGGTTATGAGCCCGGCGGGCACTCCTA GCTGCCCCACCCCGCTGCTTGACCCATTAGTTAGTGAAAGGGAGGAGGTTTATAAATCTTTCGGGCTGGGTTTATATTCC CTGAGCGCTAATCGGGACG gtgggtccgatgtacctgacgaaggaagaggagctcgttttggccggtgagtacggctac gccctccagaaagccatggagatcctcgtagccctcggagagatctatggggcggacaggctaatcccgatcaagagtgc ccagatagcgggggtctcatacaagaacctcggcgaagccggcgttgaattcctgagggactttctggaggcaggggcaa aggttagcgtctacacaactttaaatccggccggaataggagacgaagagtttatggagaagcagcgtgaagtgctcgag atttacaggaaaatgggagttgaggtgacatcaacctgcacgccttactatggagcgaacctgccgaagttcggcgatca cctggcctggagcgagagctccgccgtaagctttgcaaactccatcctaggcgcgaggacgaacagggagggcggcccat cgagtttggcctcagccataatcgggaaaactcccaactacggccttcatctcgatgaaaacaggaaggcaaccgtcctt gtgaaggttgaggcaagacttaagactttcgtcgattactccaccctcggctaccatctcggtcgggttcttggaaacga tgtgccctacataaccaacctcaaaccggaaagcgtcgattacctcaaagaactcggggcttcaatggcggcaaccggtt caatagcgctctaccacgtcgagggcgagacccccgaatacagaaccgcagttgttgacaaggtggaagagattgccgtt gaagatgccgacctcagggcagtgagggaggaattctcagacgactggagcgagattgacatgatactcatcggctgtcc tcacgcttccttgagagagattaaagaggtcgctgagctcctcaccatgcgcggaaagccgctaaaaataccgctcttca tcactgcgagcagggctgtaaaggctttagccgactcactcggttacacggagatcatagagcgctataacgggcggatt atagcggattcctgcttcgtcgtgtcgccgattaagggctggtacaacggcatcgccaccaacagcggaaagagtgcctt ctacttccgctcctttggctttaaggtcaggctcgacgatgcagagaggctcataaaagaagccccg TGAGGTGGTAGG ATGAAGCTGAGGGGAAGAAAGGTCGTCGGCGGGAAGGCAGAGGGAGAGCTGATAGTCTCGAAAAAACCACTCTCCTTCCT CGGCGGGGTTGACCCCGAGACCGGAATCGTCACCGACGCGGAGAGCGACATAAGAGGCCAGAGCATAGCGGGCAAAATCC TCGCCTTCCCACGCGGGAAGGGTTCAACGGTTGGCTCCTACGTAATCTACGCCCTTAAGAAGAACGGGAAGGCTCCAAAG GCAATAATCGTCGGTGAAGCCGAGACGATTGTCGCAACCGGGGCCATAATAGCAGGGATTCCAATGGTCCAAGGAATAGA CGTGTCCAAGCTCAAAACTGGCCAGAGGGTGAGGATCAACGCCGATGAAGGGGAGGTCGAAGTTCTCGACGGGTAGATTT TTAACCCTTCGTTCCCTCTTTTATCGGGGGAGAGCATGCCAAAGGGAATTTACGAGTGTGTTAACTGCGGTCACAGAGAG ATAATCGA