

>tg1129 Indolepyruvate ferredoxin oxidoreductase alpha subunit (iorA)

>tg1129 Indolepyruvate ferredoxin oxidoreductase alpha subunit (iorA)

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1070393 - 1073366 (Additional range around tg1129 is :500nt.)

>Thermococcus gammatolerans EJ3 TGGAGCTCTACGGCCCTCTGGGTGAACTCCAGACTTGTATATGGGCTCTCAAAAGACCTCATCTGGTTGGCCACTATCGC GACCTTAATGTCCCCGATCGCCTCCTCAACGAGTTCAAGGAGCTCTCCCACCTTCATGGAAAGACCTCAGTGTTTTCCTT AATAACCTTGTCCTCGTGCCAAAACGCTTATATCAACCGGTGAAAAGAATTTATAACGGTGGTGGGCATGGACTTTGCCC TCTTTATGGAGAGGTATGGGTACAAGATACTTCTGGGGATTTTCGCGGCGGTAGTTATAGGCATCATAGCATTCGTTGGG TTCTGGGCCTATACGCTGCTCAAAATGTTCGGAACCGTCGGGTTAATAGTAATCCTTGGCTACGCCCTTTATGCTTTCCT CGTCCAGAGACGCGTCCTCGATGCTCAGGCCAAGGCTCACGGAAAGTACTTCTATGATCCAAACTACGGAAAGAAACGCT GAGGATTCTGTGAAAATCCT ttgggttttggggcattttttcgagctacaagttttatatccttcctccaacctttgaa aggtggttgtatggagacggttaaggcttacccttctgattcgaccgaggttaaaggtgaaaggcgagagaagaagcttc tcatgggaaacgaggcgatagcctacggcgcccttgagagcggcgtcgtttttgcaaccggttaccccggaacgccctcg accgaggtcatcgagacgatagcaaggctcaagccggaagtttttgccgagtgggctcccaacgaaaaggttgcccttga ggaagcggcgggagttgcctacacgggcttgagggcgctcgtaaccatgaagtgcgtcggtttaaacgtggcagcggacc ctcttatgagcctcgcatattcaggcgtcgagggaggtctcgtgatcctcgtggctgatgacccaggcccgcacacatct caaacggagcaggacgaccgctactacggtaagatctcgctcctgcccgtccttgaacctgcagatcctcaagaggccca cgacctcatcaagtacgcctacgagctgagcgagcgctataaagtcccggtcatcttcaggacaaccacgagggttaacc acacgaccgccgacgtggaggtcggcgagttcatcgaactcgacaggaagcccgtcttcaagaaggacatcgagcgctac gtgagggccagcatggagggcaacaggaagaggcaccgctggctcaacgagacactcgccaagattgaggaggagttcaa ctcgatgcccttcaactgggtcgaggggagcggtaaaatcggaataatcgtcgagggcgcgccctacaactacgtgaagg aggttctcccgagaatcaacgcggactttaaagttctcaagctctcaacgccccacccgctaccgaagaagttggtcacc gacttcctcaaggatgtggactacgccattgtaatcgaggacggcgcgcctctcctcgaggaggaggtcaagatagccgc ctacgaggccggcttgagcgttccaatctacggcaagagaacaggccatctgccccttgagggcgagctaacgccttccc tcgtcagaaacgccctcctcaggctcatcggagaaagtgaagagacctacgagaagccagagggggtaaagctggcagag agcctcgccccgaagagaccgccggttatgtgccccggctgtccgcacaggggctcttaccgcgccgtgctggacgcgct gagggatctcaagctcggccgttacaaggtcccaatacatggcgacataggctgttacgccctctcgctcctcccaccgc tcgaagccatctggaccgagtacgtcatgggcgcgagcataagtttagcgaacgggcagagcatcgtcacggacaagaag ataatcgcgacaatcggtgactcgactttcttccacaacggaatccagcccctcatcgatgccgtctacaagaacctgaa cgttctggtgatgatactcgacaacagaaccaccgccatgaccggccaccagccccaccccggaaccgggggtagcgaaa ccggcaggaagttcaacgagatcgacatcgaggcattggtcaaggctcttggagtgaagtacgtcaagaccgtcgacccc tacgacctcaaggccacgagagaagccataaaggaggccatgcaggttgaggggccggccgtgataatagctaagcgtga gtgcgtcattcccgtcataaggcgcggggaaataggtgagctccccgttgtcatcgaggacaagtgcaccggctgtaagg cgtgcatactcctgaccggctgtccggcgctcgtctacgaccccgaaacgaacaaggtacgcatagacagcctgctctgc acgggctgtggtgtctgcaaccagacgtgccccttcgacgcgataaagttcccgagcgagctggagaggggggct TAAT CAGTTTTCTCTTTCCCCCGCAATCCTTAAATATTACTCGTTCAGTAATATACTCGGTGGGTAATATGTTCTACGACAGGT GGCGCGAGCTTGAGAAGCTCAACGAGGTTTACTCCTTTCCAGGCTCAAGCTTCCTCGTGATTTACGGCAGGCGGAGGGTT GGAAAGACTGCCTTGGCCAGGGAGTTCCTAAGGGATAAGCCAGGCCTATACTTCTTCGTTGGCGAGAAGGACGAGGCTCT GCTCCTCGAGGAGTACTCGCGCGAGATTGAGGAAAAGCTTTCCCACCACCTTCCCCCATATGTGAAGCCAAAGTTCGGCT CCCTAGAGGAGCTGGTTGAGTTCCTGCTCGACTTCTCGCAGGAGAGGAAGCTTGTTGTGGTCTTTGATGAATTCCAGAAC TTCAGGACGGTTAAACCTTCATTCTTCTCCTCCCTCCAGAGGCTCTGGGACGAGAAAAAGGAGACCTCAAACCTCATGCT CATCGCAGTTGGCTC