

>tg1130 Prokaryotic ATPase, AAA superfamily

>tg1130 Prokaryotic ATPase, AAA superfamily

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1072435 - 1074850 (Additional range around tg1130 is :500nt.)

>Thermococcus gammatolerans EJ3 GGCCACCAGCCCCACCCCGGAACCGGGGGTAGCGAAACCGGCAGGAAGTTCAACGAGATCGACATCGAGGCATTGGTCAA GGCTCTTGGAGTGAAGTACGTCAAGACCGTCGACCCCTACGACCTCAAGGCCACGAGAGAAGCCATAAAGGAGGCCATGC AGGTTGAGGGGCCGGCCGTGATAATAGCTAAGCGTGAGTGCGTCATTCCCGTCATAAGGCGCGGGGAAATAGGTGAGCTC CCCGTTGTCATCGAGGACAAGTGCACCGGCTGTAAGGCGTGCATACTCCTGACCGGCTGTCCGGCGCTCGTCTACGACCC CGAAACGAACAAGGTACGCATAGACAGCCTGCTCTGCACGGGCTGTGGTGTCTGCAACCAGACGTGCCCCTTCGACGCGA TAAAGTTCCCGAGCGAGCTGGAGAGGGGGGCTTAATCAGTTTTCTCTTTCCCCCGCAATCCTTAAATATTACTCGTTCAG TAATATACTCGGTGGGTAAT atgttctacgacaggtggcgcgagcttgagaagctcaacgaggtttactcctttccagg ctcaagcttcctcgtgatttacggcaggcggagggttggaaagactgccttggccagggagttcctaagggataagccag gcctatacttcttcgttggcgagaaggacgaggctctgctcctcgaggagtactcgcgcgagattgaggaaaagctttcc caccaccttcccccatatgtgaagccaaagttcggctccctagaggagctggttgagttcctgctcgacttctcgcagga gaggaagcttgttgtggtctttgatgaattccagaacttcaggacggttaaaccttcattcttctcctccctccagaggc tctgggacgagaaaaaggagacctcaaacctcatgctcatcgcagttggctcgtacgtcggcatgattaagcgcatcttc atggatagaaaagagcccctcttcggcagggtggacgagtgggtcaagctcaagcccttcgacttctggacttcatttaa cttcgtgcgctctctggttgatgtttcaccaaaggacttcgttgagctgtattcagcactgggcggaatgccaaggtacc tcctctacgtcccgcggtattatcgtggagactccctcaaaaccctaaaggcgctgttcttcgacgagttcgcccctctg agggaagaaggtttaaacgtccttaagctggagttcggcaggttctaccgcgctcacttctcaatcctcgaagcggtcag cctcggctacgttacgcccaaggagataagcaacaaaacgggtatgaagctactcaccgtcggcaagtacctcagcgagc tgacgaaccacttcgagtacctgacgagagaagttcccgccaccgagaaccctctgaagactaggaaagtcgcctatcgc ataagcgacgagttcttcaacttctggttccgcttcgtttaccacaactataccactcttgaagaaaatcctgagaaggc ctttgagcgctttaaagctgaatttccagccttcgttggcaaaacctacgagagaatagccctggacttcgtgagaaagc tcgaccttggctttgaaccggagcgcgtcggcaggtggtggcggggaggagaagaaatagacgtcctcacctacgaccgg aagaacattattctcttcgaggtgaagtggaaggatttgagcctgagggacgcgaggaaggttttgaagtcccttgaaag aaaggctgaactcctcccgctcaaaggggattacaggtttggcatcgtagcgagggaactcaagggtaaggaagaactca ggaaagagggctttctcgcatttgacctcaacgacgttgttcagtattccctcactccctccaaacctcgagaacca TG AAGCGCCTAACGAGCGGGTTTGGATACAGCTCCCAGCCGATTCCCTCTGTGTCTGCCTCGATTTCCCCGAAGAGGCCGCC CTCGCGCGGGTCGAGGCTCTCCCCGTAGATTTTTCCGGGCCTTATCTCGACCTCCATGTAGCGCGGGAGGCCGACGATAG CTTTCCCTTCCTTCCTCGCATAGTCAATCGCCCACTTGGCGGTGTACAGGCCGGCGTAGATTTCCGCTATTCTAACAGGG ACGCTCGACTTGCCAATGGCAATTATCTCTATTCCCGTCTCCTCCCAGAACTTCTTTGCTAAGGGCTGGAGATCCTTCGC GAGATCTTTCCAGACTTCCTTCCCGCGGTCGGTTATCGTTAAAGCGTCAATCGTCGGCTCGTCGAGCTTTCTCACCTCTA TCCCGCCGATGGTTGAGTCGAGATGGATGATGTCCGGCCTGACTTCCCTTGCGAGCTCCACCGCGAGCAATGCCTCGTCC CTAATAGCTTGCCTCCC