

>tg1139 Predicted ATPase, RNase L inhibitor-like protein

>tg1139 Predicted ATPase, RNase L inhibitor-like protein

Thermococcus gammatolerans EJ3

Sequence spaning coordinates : 1079555 - 1082324 (Additional range around tg1139 is :500nt.)

>Thermococcus gammatolerans EJ3 CAAGTCTTGCAATTGAGAACGCGGGCATAATTGAAGCTTACGAGATGGAGCGCTGGTAACTTTCACCGTAGAAACACGGG GTTTACATTGGGATTCTTAGAGTGCTGGTGGAGGCTGCCCAAGCGCACTCAGGGGGGCAGAGGTCTATCGGAGACTAAAG TCCCTGGCCTCGCTCCCAAAAGAGTACAGCACGTCTACAAATACCTTAAACTTGAAAAAGACCGGATCCGCTCGCTCGGT GGAAAGAGGTACTGGGTTGAGAACCTCCTTCTCAAGGAGGCGGTCAGGAAGTTTAATTTTCAGTGATGCCCTCTCCTTTG CTTTCCAAAACCTCCCCAGCCCTAATCGCGGCCCATTTGTCCATGAACTTCCAAGTGTGTTCTTGAGTGGAGGTGATACT TTGAAGGCCTACGTGACGGCTATCGGCACACCCCTTGAGCCCCCAACTTTTCCCCGCAACCCTTTAAAATCCTCTTCCTC AGCTTAGCCCGGTGGTGAGA atggcgaggatagctgtcatcgactacgacaagtgcaacccgaacaagtgtggtcactt cctctgcgagcgagtctgccccgtcaaccgaatgggcggtgaggcgataatcatagacgaggagaactaccgtcccatca tacaggaggccagctgtaccggctgtggaatctgcgtccacaagtgccccttcaacgcgataaccatagtaaacctgcca gaacagctcgacgaggactgcgtccaccgctacggaatcaacggcttcgtcctctaccgcctccccgtcgtcaaggaggg catggtcgtcggaatcctcgggcccaacggaacgggtaagacgaccgccgttaaaatcctctccggccagctcctgccga acctctgcggtgataacgactcctgggacaacgtgattaaggccttccgcggaaacgagctccagacgtacttcgagagg ctgaagaacaaggagattcgccccgtcgtcaagccccagtacgttgacctgattcccaaggccgtcagggggaaggtccg cgacctgctcaggaaggccgacgagagcggaaggttcgacgaggttgttaaggagcttgagctcgaaaacgtccttgata gagatataaggcacctctcgggcggtgagctccagcgcgttgccatagccgcggccctcctgagaaacgccgagttctac ttcttcgatgagccgtcgagctacctcgacataaggcagaggctcaggattgcgaaaatcataaggaagctcgccgagtc gggcaagaacgttctggcggtcgagcacgaccttgctatcctcgactacatgagcgacataattcacgtcgtctacggta agcccggcgcctacggtattttctcccagccgaaatcaacgcgcaacggcataaacgagtttctcagaggctacctccgc gatgaaaacgtccgcttcaggccctacgagataaacttcagcaagaagagcgagcgcaaaagccaggagggagaaattct cgtggagtacccgccgcttgtgaaggactacggctccttcaggcttgaggccgaggggggagagctctacatcggcgagg tggtaggaatcgtcggcccgaacggaatcggtaagacgaccttcgtgaagatgctcgccggcgtcgagaagcccaccgaa ggcgagatagactggtcgctgaccgtcagttacaagccccagtacatcaagacagactacgagggcaccgtctacgagct cctcagcaagattgacgcaggcaagctcatgagcagtttttacaagagcgagctcctgaacccgctcgggattcccgagc tctacgacaagaacgtcaacgacctttccggtggtgagcttcaacgcgtcgccataaccgcctgcctgctccgcgatgct gacctctacctcctcgacgagccctcagcgcatctcgacgtcgagcagaggttagctgtctcgaaggcaatccgctcgct gatggccaagaacgagaagactgctctcatagtcgagcacgacgtcatgatggtggactacctgagcgacaggctcatag tcttcgagggccagcccggcagattcggaaaggctagcaagccgatgggcatgcgcgagggcatgaacaggttcttggca tcagtcggggtaaccttccgcagggaccccgatacgggcagaccgagggccaacaaggaaggctccgtaaaggacaggga gcagaaggagaggggagagtactactacacc TAAAGGACCTAAAGGCTTTTCTTTTCCTTCCCCAAATTCTTTCGGTGA TGCCATGCTCCCACCGGGCAAGTTACCTCCCGAAAAGCTGGAGGAGCTCGTGTTCAGGTTCGTTGGCGGGGGAAAAGGAA GGCTCATAATCGGACCGGGACAGGGCATCGATGCCGCGGCCATAGACTTCGGTGAAACTGTACTCGTTGCCTCCACCGAC CCGATAACGGGAGCCGAGAAGAGGATCGGTTTTTACTCGGTTCACGTTAACGCCAACGACGTTGCAACCTTTGGTGCCAA GCCCCAATGGTTCCTCGCGACGGTTCTCCTGCCCGAAAATACTGAGGAGAGCCTGCTCTTAGAGATAATGAAAGAGATGT CTGAAACCGCGAGAAGGCTCGGCGTGTTGATCGTTGGCGGACACACCGAAGTTACTCCCGGCCTGGACAGGCCGATAGTC ATCGGGACGATGCTCGGCGAGGTGGAGCGGGATAGACTAGTCCTGCCGAAT